Conserved cryptic recombination signals in Vκ gene segments are cleaved in small pre-B cells

BMC Immunology

Table 3 Vκ cRS cleaved in 103/BCL2 cells and pre-B cells from RAG2:GFP and C57BL/6 mice.

Cell Type	Position	N	cRS sequence	Vκ gene	RIC ₂₃
103BCL2	232	1	cactgaa cctgtttgggactcctgaggcca gattggaca	2–116	-76.53
103BCL2	238	1	cactAct ggagaa C cgggatgggactccag gacgaagag*	17–127	-72.20
103BCL2	282	2	cacagtg ctgatggtgaaagtgaaatccgt cccatatcc	6–32	-52.01
103BCL2	282	1	cacactg ttgatactgagagtgaaatctga ccctgatcc	5–39	-54.66
103BCL2	282	1	cacactg ttgatactgagagtgaaatctgt ccctgatcc	5–45	-54.66
BM pre-B	282	2	cacagtg ctgatggtgaaagtgaaatccgt cccatatcc	6–32	-52.01
BM pre-B	288	1	agcatgc acattgctaatggtgagagtgaa gtctgtccc	8–26	NA
103BCL2	313	1	cacagta ataaacacccacatcctcagcct ccactctgc	2–116	-62.49
103BCL2	313	1	cacagta ataaacacccacatcctcagcct ccactctgc	2–109	-62.49
103BCL2	327	1	gccatga ttgtgctgacagtaataaactgc taggtcttc	8–18	NA
103BCL2	342	1	cactgtg tgaggccagctgttactctgttg acagaaata	5–45	-65.18
103BCL2	342	1	cactgtg ggagggagatacctatgctgtag acagaaata	11–106	-69.65
BM pre-B	342	2	cactgtg ggaggagagctataatcctgctg acagaaata	6–32	-66.82
103BCL2	342	1	cactgtg ggaggagagctataatcctgctg acagaaata	6–32	-66.82
103BCL2	342	1	cactgtg ggaggaaactcataaaactgtag acagtaata	14–130	-70.3
BM pre-B	342	1	cactgtg ggaggaaactcataaaactgtag acagtaata	14–130	-70.3

LM-PCR products from 103/BCL2 cells and from pre-B cells isolated from RAG2:GFP knock-in mice or from C57BL/6 mice were sequenced and aligned to sequences from the IMGT reference directory set to identify the germline gene segment. Where matches to IMGT sequences were not found, the LM-PCR products were aligned to germline Vκ gene segments in NCBI (indicated in bold). The source, location, number of observations, cRS sequence, Vκ gene segment, and cRS sequence RIC score are shown for each independent cleavage event. cRS sequences are written in heptamer-to-nonamer orientation, and nucleotide positions using IMGT numbering indicate the location of the first heptamer nucleotide.
* The LM-PCR product shows 2 mismatches to the genomic cRS sequence (cactGctggagaaTcgggatgggactccaggacgaagag), indicated with capital letters. We attribute this difference to sequencing error.

ISSN: 1471-2172