Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences and their applications in this study.

From: Structural and functional studies of STAT1 from Atlantic salmon (Salmo salar)

Primer name Sequence 5' - 3' Application
rtSTAT1fw CACCATGGCCCAGTGGTGCCAGCTGCA Gene cloning/sequencing
rtSTAT1rev CTACTATCAGTTGCAGTCCGAGTCAGGTG Gene cloning/sequencing
ssSTAT1 2204 fw AGTGTTGGACTGGTCCTAAGGA Isoform detection (PCR)
ssSTAT 1gap rev TGAAATTCTTCAGCTAAAAACTCTC Isoform detection (PCR)
ssSTAT1fw CGGGCCCTGTCACTGTTC qPCR
ssSTAT1rev GGCATACAGGGCTGTCTCT qPCR
ssSTAT1 probe ACCACCAAGGAATGTTC qPCR