Skip to main content

Table 2 Oligonucleotide sequences of ovine GAPDH and a selected range of genes employed for SYBR Green real time PCR

From: The gastrointestinal nematode Trichostrongylus colubriformis down-regulates immune gene expression in migratory cells in afferent lymph

Gene Forward primer (5'-3') Reverse primer (5'-3')
GAPDH CACCATCTTCCAGGAGCGAG CCAGCATCACCCCACTTGAT
Novel Gene CAAGCTAAAGGCAGCATCCC TCTCCCTCATAAGCCTGGAGC
GNLY GGTCTGCAAAAGCAAGGCAG TCAGAGGACCCAGGGAATCA
SLA ACCACGGTTGGCTGTTTGAA GCAGCTCCTCAGCCTTGTCT
CXCR3 GTGCTGACACTCCCTCTCTGG AAAGACCCACTGGATGGCTG
TRAF3 CTTCTGTGAGACCTGCATGGG CATTTTGGGCTGGAGGAGC
TLR6 AATGACTTTGATGCCCTGCC CTGGGTCAAGTTGCCAAATTC
LOC509457 AAGGGATACGGGAACTTGGC AAAGGGCTTCATTGCTGAGC
  1. aPrimers were designed to the ovine homologues of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), the src-like adaptor (SLA), chemokine (C-X-C) receptor 3 (CXCR3), TNF receptor-associated factor 3 (TRAF3), toll-like receptor 6 (TLR6), granulysin (GNLY), predicted WD repeat domain 73 (LOC509457) and a novel ovine EST (Novel Gene).