Skip to main content

Table 4 qRT-PCR primer sequences

From: Anti-inflammatory effects of tetradecylthioacetic acid (TTA) in macrophage-like cells from Atlantic salmon (Salmo salar L.)

ID/Gene.Acc.Nr. Gene Forward primer Reverse primer
AF321836 EF1α CACCACCGGCCATCTGATCTACAA TCAGCAGCCTCCTTCTCGAACTTC
KSS1708 ACADM GCCATCTCAGCCAACAGGAA GACAAGACCAGACCGCCAGT
GRASP209147493 S6A13 CCGTATGGGGGATGATGCTAA GGTAGTATGCTGACGACTGACACCT
S35506608 HSP70 AAGGCAAGATCAGCGAGGAG TGCCTGATCTCCACAGCAAC
GRASP209153907 ANGL4 AGGAGATGCAGCAGGAGAGG TTCTGAGCTTCCAGCATCCA
S32493348 TLR3 TCCAAGCCTGGTGACTCTCA CAGGTGGAGGACTCGTTAGGG
TC102663 UBA1 GCACTGTTTCCCCTCTGACC AGCAGTCTCGTGTTCCCACA
AF321836 TNFα (1+2) GCTTGTCTCTTGTTGCCACCA TGTGTGGGATGAGGATTTGGTT
AF088999 COX2 ACCTATGGGAACCGCAGGA GTGAAGTGCTGGGCGAAGA
EG929369 ARG1 AGCCATGCGTATCAGCCAA AAGGCGATCCACCTCAGTCA
AJ416951 PPARγ CATTGTCAGCCTGTCCAGAC TTGCAGCCCTCACAGACATG
EF165028 IL10 ATGAGGCTAATGACGAGCTGGAGA GGTGTAGAATGCCTTCGTCCAACA
AY216594+AY216595 IFα (1+2) TGCAGTATGCAGAGCGTGTG TCTCCTCCCATCTGGTCCAG
SSU66477 MX TGATCGATAAAGTGACTGCATTCA TGAGACGAACTCCGCTTTTCA
AY617117 IL1β AGCAGGGTTCAGCAGTACAT CTCCATAGCCTCACTCATCA