Skip to main content

Advertisement

Table 2 Sequences of the primers used for molecular cloning.

From: Impact of acute stress on antimicrobial polypeptides mRNA copy number in several tissues of marine sea bass (Dicentrarchus labrax)

Primer name 5'→3' sequence Purpose
Hemoglobin FW1 ATGGTCCAGTGGTCAGATGC RT-PCR
Hemoglobin RV1 CTTCAGGCTTCTTGCTGAATG  
Hemoglobin FW2 TGGACAGGGCTGTGAAGAAC  
Hemoglobin RV2 AAGTTCCTGGCTGTGGTCGT  
HLP1 FW1 AAGAAGGGCTCCAAGAAAGC  
HLP1 RV1 GCACTAAAGCGGTGACGAA  
HLP1 RV2 ACCATCACCTCCAGGGAGAT  
HLP1 RV3 GGCTAAACACGCAGTGTC  
HLP1 RV4 GGCTAAGCACGCCGTGTC  
HLP2 FW1 CCAAAGCGCCCAAGAAGA  
HLP2 RV1 TAAAGGCATCCTGCTGCAG  
HLP2 FW2 TGTCTCTCGCTGCTCTGAAG  
HLP2 RV2 CAAGAAGGCCAAGAAACCC  
T3 Hb-LP sense caattaaccctcactaaaggga ATGGTCCAGTGGTCAGATGC Standard curve
Hb-LP antisense AAGTTCCTGGCTGTGGTCGT  
T3 HLP1 sense caattaaccctcactaaaggga AAGAAGGGCTCCAAGAAAGC  
HLP1 antisense ACCATCACCTCCAGGGAGAT  
T3 HLP2 sense caattaaccctcactaaaggga CCAAAGCGCCCAAGAAGA  
HLP2 antisense CAAGAAGGCCAAGAAACCC  
T7 Dicentracin sense gtaatacgactcactataggg AGTGCGCCACGCTCTTTC  
Dicentracin antisense CTAGTCAAAAGCTGCGCGCT  
Hb-LP Forward GGTCCAGTGGTCAGATGCA Real time
RT-PCR
Hb-LP Reverse ACGATCAGAAGTCTGGTCAAAGC  
Hb-LP Taqman® probe CCGCCATCACAAGCTGG  
HLP1 Forward CGTGTCTAAGGTCACCAAGA  
HLP1 Reverse GTACACGTAGATGGCGTAGCT  
HLP1 Taqman® probe CCGGCAAGAAGAAGAG  
HLP2 Forward CCCAAGAAGAGAGCCAAGTCT  
HLP2 Reverse CTGATACTGAAGGCCGCGT  
HLP2 Taqman® probe AAGAAGAAGACGGGTCCCTC  
Dicentracin Forward TGCGCCACGCTCTTTCTT  
Dicentracin Reverse CCCCAGGTTCAGCCATGAG  
Dicentracin Taqman® probe ACGACCATCGACAGCAC