Skip to main content

Table 3 q-RTPCR confirmation of LT-induced genes.1

From: Bacillus anthracis’ lethal toxin induces broad transcriptional responses in human peripheral monocytes

Probe Microarray q-RT-PCR Gene name Primer sequence
38290_at 5.61 7.40 RGS14-F CAGGGATCTGTGAGAAACGAG
    RGS14-R AGGTGATCCTGTTTTCCAGC
207008_at 5.04 7.50 IL8RB-F GTCTAACAGCTCTGACTACCAC
    L8RB-R TTAAATCCTGACTGGGTCGC
210166_at 3.90 2.24 TLR5-F TTTTCAGGAGCCCGAGC
    TLR5-R AGCCGAGATTGTGTCACTG
212686_at 2.65 3.85 PPM1H-F GAGTACAGAGAAAGGAGCTTGG
    PPM1H-R TCCAATAGTTGCCATTACCCG
226016_at 2.38 1.60 CD47-F TTTGCTATACTCCTGTTCTGGG
    CD47-R TGGGACGAAAAGAATGGCTC
209269_at 2.15 1.60 SYK-F CAAGTTCTCCAGCAAAAGCG
    SYK-R CATCCGCTCTCCTTTCTCTAAC
206991_at -2.66 -2.33 CCR5-F CCAAAAGCACATTGCCAAACG
    CCR5-R ACTTGAGTCCGTGTCACAAGCC
205403_at -12.5 -28.0 IL1R2-F TGGCACCTACGTCTGCACTACT
    IL1R2-R TTGCGGGTATGAGATGAACG
  1. 1 Calculated fold changes comparedtomock treated samples.