Skip to main content

Table 1 Primers for steady-state mRNA and primary transcript

From: IL-10 transcription is negatively regulated by BAF180, a component of the SWI/SNF chromatin remodeling enzyme

Locus Primer name Primer 1 Primer 2
IL-4 MP 588 ACAGGAGAAGGGACGCCAT GAAGCCCTACAGACGAGCTCA
IL-13 MP 590 AGACCAGACTCCCCTGTGCA TGGGTCCTGTAGATGGCATTG
IFN-γ MP 592 GGATGCATTCATGAGTATTGC CCTTTTCCGCTTCCTGAGG
IL-5 MP 779 AGCACAGTGGTGAAAGAGACCTT TCCAATGCATAGCTGGTGATTT
IL-17A MP 1018 ATCAGGACGCGCAAACATG GCAGCAACAGCATCAGAGACA
IL-17 F MP 1020 ATTCCAGAACCGCTCCAGTTC GGGTCTCGAGTGATGTTGTAATCC
IL-10 MP 1016 GGCGCTGTCATCGATTTCTC GCTCCACTGCCTTGCTCTTATTT
IL-10 pri MP 1082 CCAATGGGTACTAACCAGATGCT AATTCATTCATGGCCTTGTAGACA
T-bet MP 602 CAACAACCCCTTTGCCAAAG TCCCCCAAGCAGTTGACAGT
GATA3 MP 604 AGAACCGGCCCCTTATCAA AGTTCGCGCAGGATGTCC
RORγT MP 1564 CTGTTTCGAGCCTTGGGCT AAAGTCAAATATGGAGCTGATGAGC
actin MP 598 AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT
TBP MP 935 CTTCGTGCAAGAAATGCTGAATAT TGTCCGTGGCTCTCTTATTCTCA