Skip to main content

Table 2 Primers for ChIP and DNase hypersensitivity

From: IL-10 transcription is negatively regulated by BAF180, a component of the SWI/SNF chromatin remodeling enzyme

Locus Primer name Primer 1 Primer 2
IL-10-30.4 MP 1116 GCCCTTCTGGAGCTGGTTAGT TCATACTTGGGCATGGAAATTTC
IL-10-29.8 MP 1117 GCTCTTGCTGCACATAATTCTGTAC TGAAAGACTAGAACAAATGTGAACGA
IL-10-25.9 MP 2014 TCTGTTCCCAACTTAGGCTGC GACCCACCAAAAGCTTCTGG
IL-10-23.3 MP 2015 CCTGGATGCGAAAGACCTCA TGTGGATGGAGGGAGCATTC
IL-10-20.7 MP 1118 TGGATTGGCATGGGTAGAGAA ATCACCCCAGACTGGATGTCA
IL-10-20.1 MP 1119 CCCTCCAGGTCTCGTCTCAAG CTTTTGATTCCCATGCCTTACC
IL-10-17.2 MP 1120 CCTGCCTCATTATTAGCGTCTCTT CATGGCCTTGGAAATAATATGCA
IL-10-17.0 MP 1121 TGAGAAGGTAAGAGGTTGCCATTA TCTCTCCCCTGCCTCTTTTTC
IL-10-9 MP 911 AACACAGGTGAACACGCAAAAG CTGGAAGTGCCATTCTGTAAGAGA
IL-10 pro MP 913 GCCCATTTATCCACGTCATTATG TGTTCTATGTACAGAGGCCCTCATC
IL-10 +1.8 MP 1246 GGTCTCTTGCTCATCTGTCTCTGA AGGCTATGCGCAAATCTTCAC
IL-10 +3.2 MP 2016 CTCCCCCAAATCAGAACGAG GCCCCGGGACAAGTAAGAAT
IL-10 +6.2 MP 2017 GCAGAGAGTGGGATGGCTCA TCTCACTGGTGCCCGCA
IL-10 +18 MP 2018 AGGAGTTCAGGAGGCATGGA TCACCATGTCTTGTGGTAACAGC
Nfm MP 855 CCACGGCGCTGAAGGA CTGGTGCATGTTCTGGTCTGA