Skip to main content

Table 1 Outline of primers for IL1A, IL1B SNP genotyping

From: Genetic variants in IL1A and IL1B contribute to the susceptibility to 2009 pandemic H1N1 influenza A virus

Gene SNP ID Polymorphisms Forward primer Reverse primer Un-extension primer
(5′-3′) (5′-3′) (5′-3′)
IL1A rs1304037 A > G ACGTTGGATGTCGATTAAGAGTTCATCAGC ACGTTGGATGAGCCACAGACCTAGGATTTC AGTTCATCAGCAACTTAAAAG
rs16347 DEL > TGAA ACGTTGGATGGTAGGACTTGATTGCAGGTG ACGTTGGATGTTGAGCCAGTAATTGGTCCG TGCAGGTGGAATTGAA
rs17561 G > T ACGTTGGATGGGTTTTAGAAATCATCAAGCC ACGTTGGATGGAATTCGTATTTGATGATCC TCATCAAGCCTAGGTCA
rs2071373 C > T ACGTTGGATGTGATGTGCATTGGCTTCTCC ACGTTGGATGAACATCCTGATGAAGCCTGC TCCCAGAACAGAGCAGAAC
IL1B rs1143623 G > C ACGTTGGATGATGTGCCAGGTATCGTGCTC ACGTTGGATGACCTATTTCCCTCGTGTCTC GCTCGCTCTGCATTAT
rs3917345 DEL > TGGT ACGTTGGATGTGCTGGTGTCTCGGTTAAAG ACGTTGGATGTCTGAGACTCTATCTCTTGG AGAGAAACTGATAACTCTTGGT
rs1143627 T > C ACGTTGGARGCCTCGAAGAGGTTTGGTATC ACGTTGGATGTCTAGCCTCCTACTTCTGC ATCCCTCGCTGTTTTTAT