Skip to main content

Table 2 Primer sequences used for house-keeping genes and cytokine related molecules real-time PCR assays

From: Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green

Gene name 5'-3' primer sequence Position cDNA-genea Accession Numberb
βactin FW AAGTCCCTCACCCTCCCAAAAG 3474–3570 J00691
  RW AAGCAATGCTGTCACCTTCCC Exon V01217
CypA FW TATCTGCACTGCCAAGACTGAGTG 381–507 M19533
  RW CTTCTTGCTGGTCTTGCCATTCC Int. span. NW_047430
GAPDH FW GTATTGGGCGCCTGGTCACC* 73–274 AB017801
  RW CGCTCCTGGAAGATGGTGATGG Exon NW_047696.1
HPRT FW CTCATGGACTGATTATGGACAGGAC 211–333 S79292
  RW GCAGGTCAGCAAAGAACTTATAGCC Int. span. NW_047696.1
SOCS3 FW CCTCCAGCATCTTTGTCGGAAGAC 581–679 AF075383
  RW TACTGGTCCAGGAACTCCCGAATG Exon AJ249240
C/EBPβ FW TGGACAAGCTGAGCGACGAG 656–760 NM_024125
  RW TGTGCTGCGTCTCCAGGTTG Exon NW_047660.1
cFos FW TTCACCCTGCCTCTTCTCAATGAC 849–931 X06769
  RW GCCTTCAGCTCCATGTTGCTAATG Int. span. NW_047762
cJun FW CAATGGGCACATCACCACTACAC 604–725 X17163
  RW TCTGGCTATGCAGTTCAGCTAGG Exon NW_047717.1
COX-2 FW TGTATGCTACCATCTGGCTTCGG 981–1074 S67722
  RW GTTTGGAACAGTCGCTCGTCATC Exon NW_047397.1
I-KB FW TGAGTACCTGGACTTGCAGAACG 334–409 AF246634
  RW TGTAGATGCCTCTCCAAGGATGG Int. span. NW_047557.1
NOS-2* FW CATTGGAAGTGAAGCGTTTCG 2103–2197 L12562
  RW CAGCTGGGCTGTACAAACCTT Int. span. AABR03074184
  1. Note. FW forward primer; RW reverse primer; CypA, cyclophilin A; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HPRT, hypoxanthine-guanine phosphorybosyl transferase; SOCS3, Suppressor of cytokine signalling 3; C/EBPβ (NF-IL6 rodent homologue); COX-2, cyclooxygenase 2; I-KB, KappaB inhibitors; NOS-2, nitric oxide synthase 2. a Position of amplification product within cDNA sequence (upper line) and within genomic sequences (lower line). Exon; both primers bound on the same exon, Int. span.: primers bound on different exons, , b Genbank accession number of cDNA (upper line) and genomic sequences or contigs (lower line), available at http://www.ncbi.nlm.nih.gov/ *primers are stemmed from mouse sequence. ‡ gene without intron.