Skip to main content

Table 4 Primer sequences and detailed PCR conditions used to generate standard recombinant DNA.

From: Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green

Gene name 5'-3' primer sequence Positiona (cDNA) Annealing temperatureb
IL1a FW GTGGTGGTGTCAGCAACATCAAAC 275–862 56°C
  RW GAAATCTATCATGGAGGGCAGTCC   
IL1b FW TGAAAGCTCTCCACCTCAATGGAC 501–894 57°C
  RW TGCAGCCATCTTTAGGAAGACACG   
IL1RA FW AAGACCTTCTACCTGAGGAACAACC 139–310 55°C
  RW GCTTGGTGTCATCTCCAGACTTG   
IL1R1 FW TGTCTACTGGAAGTGGAATGGGTC 1143–1500 56°C
  RW GGGAAGAAAATCAGAGCAGGAGTC   
IL1R2 FW CACCCAGTTCTTGGAGACGATTG 226–598 57°C
  RW TGGAGGAGAGAGCTGAGATTTGC   
IL6 FW TCTGGAGTTCCGTTTCTACCTGG 388–682 55°C
  RW CATAGCACACTAGGTTTGCCGAG   
IL6R FW AGCAGGCAATGCTACCATTCAC 264–873 57°C
  RW GTCGGTATCGAAGCTCGAATTG   
TNFa FW AGCACAGAAAGCATGATCCGAG 4–499 58°C
  RW CCTGGTATGAAGTGGCAAATCG   
TNFR2 FW TCAGATGTGCTGTGCTAAGTGTCC 93–512 58°C
  RW GCCAGGATGCTACAAATGCG   
SOCS3 FW ATGGTCACCCACAGCAAGTTTC 18–679 56°C
  RW TACTGGTCCAGGAACTCCCGAATG   
  1. Abbreviations: see Tables 1, 2. These primer sets allow generating recombinant DNA to ensure the specificity of the PCR amplification or to generate standard curves. a Position of amplification product within cDNA sequence. Genbank accession number are given in Tables 1, 2, b melting temperature of specific PCR product.