Skip to main content

Table 1 Primers for Real-Time PCR1

From: Profiling helper T cell subset gene expression in deer mice

Gene Forward Reverse Size (bp) Acc#
GAPDH GGTGCCAAAAGGGTCATCATCTC GCAGGAAGCGTTGCTGATAATCTTG 114 AY841947
IFNγ GGCTATTTCTGGCTGTTACTGCC ATCCCCGACATCTGAGCTACTTG 94 AY289494
TNF TGTAGCCCACGTTGTAGCAAACC CTGGTTGTCTTTGAGATCCATGC 106 AF307013
LTA ATGGTGTCTCCCATCTACACTTCAG TTGAAACGGTCAGCATGGAGG 115 AF348259
IL-4 CCCCGTGCTTGAAGAACAATTC GGACTCATTCCCAGTACAGCTTTTC 104 DQ446203
IL-5 GAAGAATCAAACTGTCCGTGGG ACACTGCTCTTTTTGGCGGTC 94 AY843530
TGFβ1 CGTGGAACTCTACCAGAAATACAGC TCAAAAGACAACCACTCAGGCG 96 AY455973
IL-10 TAAGGGTTACCTGGGTTGCCAAG CAAATGCTCCTTGATTTCTGGGC 106 AF307012
GATA3 AGTCCGCATCTCTTCACCTTCC GGCACTCTTTCTCATCTTGCCG 112 AY325113
T-bet GATCATCACTAAGCAAGGACGGC AGACCACATCCACAAACATCCTG 101 AY271903
Fox-p3 AAGCAGATCACCTCCTGGATGAG TAGCACCCAGCTTCTCCTTTTCC 114 AY841945
STAT4 AACCATTTACCTTCTGGACCTGG TTGCTCACGAAGCCCATGATGTACC 103 AY455975
STAT6 CGCTTTAGCGACTCTGAGATTGG TCTTTGGCAGAAAATGGCTGG 104 DQ836357
  1. 1All sequences are listed 5' to 3'.