Skip to main content

Advertisement

Table 1 Primers used for Quantitative real-time PCR

From: PHF11 expression and cellular distribution is regulated by the Toll-Like Receptor 3 Ligand Polyinosinic:Polycytidylic Acid in HaCaT keratinocytes

Primer Product size (bp) Sequence (5’-3’)
Forward (F), Reverse (R)
Claudin-1 109 F: GGTCAGGCTCTCTTCACTGG
R: GCCTTGGTGTTGGGTAAGAG
IL-8 109 F: TCTGCAGCTCTGTGTGAAGG
R: AAATTTGGGGTGGAAAGGTT
ISG15 97 F: AGCATCTTCACCGTCAGGTC
R: GAGAGGCAGCGAACTCATCT
KRT10 91 F: CCTGGCTTCCTACTTGGACA
R; TTGCCATGCTTTTCATACCA
KRT14 90 F: TCCTCAGGTCCTCAATGGTC
R: CGACCTGGAAGTGAAGATCC
KRT1 110 F: CAACCAGAGCCTTCTTCAGC
R: AGGAGGCAAATTGGTTGTTG
PHF11 140 R: TCCTGCTTCCTTGCATTTCT
F: GGAAGGAAGAAACCCCTCTC
SDHA 86 F: TGGGAACAAGAGGGCATCTG
R: CCACCACTGCATCAAATTCATG