Skip to main content

Table 1 Primer sequences

From: Differential development of oil granulomas induced by pristane injection in galectin-3 deficient mice

Gene Primer sequence (5’-3’)
 β-actina Forward: AGCTGCGTTTTACACCCTTT
Reverse: AAGCCATGCCAATGTTGTCT
 IL-12p40 Forward: AACCATCTCCTGGTTTGCCA
Reverse: CGGGAGTCCAGTCCACCTC
 iNOS-2 Forward: CCGAAGCAAACATCACATTCA
Reverse: GGTCTAAAGGCTCCGGGCT
 Arginase-1 Forward: CAAAAGGACAGCCTCGAGGAG
Reverse: CCCGTGGTCTCTCACGTCAT
 IL-6 Forward: TCAATTCCAGAAACCGCTATGA
Reverse: GAAGTAGGGAAGGCCGTGGT
 TNF-α Forward: GACGTGGAACTGGCAGAAGAG
Reverse: GCCACAAGCAGGAATGAGAAG
 MIP-2 Forward: ATCCAGAGCTTGAGTGTGACGC
Reverse: AAGGCAAACTTTTTGACCGCC
 Cxcl-1 Forward: AAAAGGTGTCCCCAAGTA
Reverse: AAGCAGAACTGAACTACCATCG