Skip to main content

Table 1 List of gene-specific primer sequences used for quantitative real-time PCR

From: Inhibition of Notch 1 receptor influenced the differentiation of Lin-CD45RA-dendritic cell precursors within ovarian carcinoma microenvironment

Gene Forward Primer Reverse Primer
GAPDH 5‘CACCCACTCCTCCACCTTTG3' 5‘CCACCACCCTGTTGCTGTAG3'
Notch1 5’GTCAACGCCGTAGATGACC3’ 5’TTGTTAGCCCCGTTCTTCAG3’′
Jagged1 5’GCTTGGATCTGTTGCTTGGTGAC3’ 5’ACTTTCCAAGTCTCTGTTGTCCTG3’
Jagged2 5’ GCTATTTCGAGCTGCAGCTGAG3’ 5’GCGGCAGGTAGAAGGAGTTG 3’
Delta 1 5’CTACACGGGCAGGAACTGCAG3’ 5’CGCCTTCTTGTTGGTGTTCTTG3’