Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Sequences of the primers used in the qRT-PCR and the amplified product sizes

From: Silencing of CD47 and SIRPα by Polypurine reverse Hoogsteen hairpins to promote MCF-7 breast cancer cells death by PMA-differentiated THP-1 cells

Target gene Forward sequence (5′-3′) Reverse sequence (5′-3′) Product size (bp)
GAPDH CCATGTTCGTCATGGGTGTGAACCA GCCAGTAGAGGCAGGGATGATGTTC 251
CD14 GCAGCCGAAGAGTTCACAAG CGCGCTCCATGGTCGATAAG 129
CD47 GAGTCTCTGTATTGCGGCGTG GGGGTTCCTCTACAGCTTTCC 161
IL-1β GTGGCAATGAGGATGACTTGTTC TAGTGGTGGTCGGAGATTCGTA 124
IL-18 CCTCAGACCTTCCAGATCGC TTCCAGGTTTTCATCATCTTCAGC 159
IL-6 CATTTGTGGTTGGGTCAGG AGTGAGGAACAAGCCAGAGC 112
IL-8 CCACCGGAAGGAACCATCTC TTCCTTGGGGTCCAGACAGA 279
Mcl-1 GACGAGTTGTACCGGCAGTCG TTGATGTCCAGTTTCCGAAGC 200
SIRPα AAATACCGCCGCTGAGAACA TGTCCTGTGTTATTTCTCTGGCA 197
TNF-α GCCAGAGGGCTGATTAGAG TCAGCCTCTTCTCCTTCCTG 124