Skip to main content

Advertisement

Table 1 List of gene specific primers sets used for PCR and cDNA for RACE

From: The UT family of MHC class I loci unique to non-eutherian mammals has limited polymorphism and tissue specific patterns of expression in the opossum

Gene Exon 2 F Exon 2 R Intron 2 F Intron 2 R Exon 3 F Exon 3 R Length Overlap
ModoUT2 TGCTCTCCAGCTCTCCACA      ATCTTCAGAAATGTTGGGCACT 689 bp  
ModoUT3 ACCACAGCCATATAGGTCAGTTC      TCAAGTCAACACAATAGAGCTTCA 824 bp 812 bp,  
ModoUT4 CCTTCCTATAATCTAGTCCACCACA   CAATCATGGGGGTTAGAAACAT TCCCCAAATTCTTAGTGCAGTT   TCCAACAATTTTCTTCATCAAGTC 742 bp 207 bp
ModoUT5 CCTATAATTCAGTCCACCACAGG      CTCACCATTATCCCTTATGCTTG 855 bp 837 bp,  
ModoUT6 CCTTCCTATAATTCAGTCCACCA   GTCCCATGCTCTTTTTCAGTTC TCTCATGTTATGCCATGTGTCC   TTCCTTAAGTTTGAATACCCAATG 779 bp 753 bp, 244 bp
ModoUT7 CACACTATAACTTCATGTAGTGTTTCC   GCTGCTTGCAGGAGTAAAAGAT GACTTTCAGAGTTTGCCAAAGG   CCTATAATTCAGTCCACCACAGG 682 bp 816 bp, 150 bp
ModoUT8 GTTCTGCAGCTCACCACAAAC   CTCATCCACCAGTGTGTTGTTC GGGTAGGAGCTTCATGTCAGTC   CTTGCATGTAGTGCTTCCTCTG 738 bp 286 bp, 96 bp
ModoUT9 CCCATATATGACCTGCTTTCCT GTGGAGGTGGAAATAAGTGAGG    TTAGCCTGGCCATAATACTTCC GGGAAATATGACTTGTACCTCCTG 450 bp 346 bp,  
ModoUT10 CCCCTACCTTTCTGTCATTCAG GGACAAGCGCTTTTTGAGTATG    TTCATCTCCAATTCTGATTCCA GATTGGTTAGAGCCTGTGCTTT 354 bp 833 bp,  
ModoUT15 GCTTTCACTCCTGTCTCTCAGC   ACCTCGAAGGTCATCTAGTCCA TGTCCTTTGAAACCTAGGCAAT   TCATGCTTGAATGCTGTAGAAC 876 bp 229 bp, 138 bp
ModoUT17 CTTTTCTGTCCTTTAGCCCATC CCCCTCTCTTATCATTCTTTACC    CCAGAGAACCATACAGTCCAGAT TGTTTGACTGTAGGACTTTCCTC 210 bp  
  5’ RACE R 5’ RACE R nested 3’ RACE F 3’RACE F nested overlap    
ModoUT4 TTCATGTTCTCCCAGTGCCCAACC   GAAACCACACAGCCCAGCTCCAG   89 bp    
ModoUT5 TGTGCCAACTCCAGTCAACTGTCCC   GGGACAGTTGACTGGAGTTGGCACA   0 bp    
ModoUT6 AGACTGGTCCAGAGGGGACTCTC   CTGGAGAGTCCCCTCTGGACCAGTCT   0 bp 363 bp,    
ModoUT8 GTGGTCCACAGGTTACTTGTCA TGGATTTCATTTCCTAGCTGGT GGAAGCTCCCTCTTGGAATACT TCATAGAGGACACTTGGCAGAA 119 bp