Skip to main content

Table 1 Primers used for Real-time PCR

From: Lipopolysaccharide mediates immuno-pathological alterations in young chicken liver through TLR4 signaling

Gene Primer sequences (5′to3′) Accession no.
actin beta f-TTGTTGACAATGGCTCCGGT
r-TCTGGGCTTCATCACCAACG
NM_205518.1
TLR4 f-TGAAAGAGCTGGTGGAACCC
r-CCAGGACCGAGCAATGTCAA
NM_001030693.1
MyD88 f-AGGATGGTGGTCGTCATTTC
r-TTGGTGCAAGGATTGGTGTA
NM_001030962.2
NF-κB f-CTACTGATTGCTGCTGGAGTTG
r-CTGCTATGTGAAGAGGCGTTGT
M86930.1
TNF-α f-CAGATGGGAAGGGAATGAAC
r-CACACGACAGCCAAGTCAAC
AY765397.1
IL-1β f-ACCTACAAGCTAAGTGGGCG
r-ATACCTCCACCCCGACAAGG
NM_204524.1
TGF-β f-ATGTGTTCCGCTTTAACGTGTC
r-GCTGCTTTGCTATATGCTCATC
NM_205454.1
caspase-3 f- TCCACCGAGATACCGGACTG
r- ACAAAACTGCTTCGCTTGCT
NM_204725.1
caspase-8 f- CGGATCAATCGAATAGACCTTC
r- CGGCATTGTAGTTTCAGGACTT
NM_204592.2
PCNA f- TCTGAGGGCTTCGACACCTA
r- AACCTTTTCCTGATTTGGTGCTT
NM_204170.2