Skip to main content

Table 1 Primer name, sequence and product length

From: Establishment of malignantly transformed dendritic cell line SU3-ihDCTC induced by Glioma stem cells and study on its sensitivity to resveratrol

Primer name Primer sequence(5′-3′) Product length
EGFP F:GCCACAAGTTCAGCGTGTCCG
R:GTTGGGGTCTTTGCTCAGGGCG
566 bp
RFP F:AGGTTCTTAGCGGGTTTCTTG
R:CTTCCCTGAGGGCTTCACAT
312 bp
CD68 F:CTACATGGCGGTGGAATACAATG
R:TAGCCTTAGAGAGAGCAGGTCAA
175 bp
F4/80 F:CAGCTGTCTTAGAGGCTTCTCTT
R:TGTAGCTTCCCACAGAGTTAGAG
149 bp
CD1a F:GAGTTGTTTCGTCAGTTTCCATAG
R:GGAGGCCCTTGGAGTTATCATT
452 bp
CD83 F:CTCTACTGGGCTGTTACCTTGTT
R:GAGGAGTTCACACAGAAGACCAT
138 bp
CD86 F:GCCTGAGTGAGCTGGTAGTATTT
R:TGTGAAGTCGTAGAGTCCAGTTG
150 bp
β-actin(H) F:ACATCCGCAAAGACCTGTAC
R:GCCATGCCAATCTCATCTTG
346 bp
β-actin(M) F:CTTTGCAGCTCCTTCGTTG
R:TGGTAACAATGCCATGTTCA
278 bp