Skip to main content

Table 1 Primers used for RT-PCR

From: Sustained high glucose exposure sensitizes macrophage responses to cytokine stimuli but reduces their phagocytic activity

Name Forward Reverse
Arg-1 TTATCGGAGCGCCTTTCTCAA TGGTCTCTCACGTCATACTCTGT
IFNγR1 GGTTGCTCCTCTTACCGTCT GTGCGGTGTGACAAGTGAAT
IFNγR2 TGCTTCACCCTGTTCCTCAA CTGGTTCACGGTGTTTGGAG
IL-10 TGCAGGACTTTAAGGGTTACTTGG GGCCTTGTAGACACCTTGGTC
IL-12p40 GACATCATCAAACCAGACCCGCC GCCTTTGCATTGGACTTCGGT
IL-1β TCCTTGTGCAAGTGTCTGAAGC ATGAGTGATACTGCCTGCCTGA
IL4ra TGGCTGCTGACCTGGAATAA TCAGCCTGGGTTCCTTGTAG
IL-6 TCTGCAAGAGACTTCCATCCAGT TCTGCAAGTGCATCATCGTTGT
iNOS GGCAAACCCAAGGTCTACGTT TCGCTCAAGTTCAGCTTGGT
Rn18s AGGGGAGAGCGGGTAAGAGA GGACAGGACTAGGCGGAACA
TLR-4 TCCTGGCTAGGACTCTGATCAT TCCAGCCACTGAAGTTCTGA
TNFα GCCTCTTCTCATTCCTGCTT CTCCTCCACTTGGTGGTTTG