Skip to main content

Table 1 Primers used for real-time PCR in this study

From: Treponema pallidum promotes macrophage polarization and activates the NLRP3 inflammasome pathway to induce interleukin-1β production

Genes Primers (5′ → 3′)
NLRP3 Forward AACAGCCACCTCACTTCCAG
Reverse CCAACCACAATCTCCGAATG
Caspase-1 Forward GCACAAGACCTCTGACAGCA
Reverse TTGGGCAGTTCTTGGTATTC
IL-1β Forward GATGGCTTATTACAGTGGC
Reverse CCTTGCTGTAGTGGTGGT
GADPH Forward GAAGGTGAAGGTCGGAGTC
Reverse GAAGATGGTGATGGGATTTC
iNOS Forward CAGCATCCACGCCAAGAA
Reverse CAGGTGTTCCCCAGGTAGGTAG
TNF-a Forward ATGAGCACTGAAAGCATGAT
Reverse GGGCTGATTAGAGAGAGGTC
CD206 Forward GATACCTGCGACAGTAAACGA
Reverse CTGGCTATAAGGGAATTGTGAAG
IL-10 Forward GGGTAAGCCATAAGCGAATC
Reverse GGGCAACAAGAGCGAAACT