Skip to main content

Table 1 Primers used for the generation of recombinant rat monoclonal antibodies

From: A novel approach for rapid high-throughput selection of recombinant functional rat monoclonal antibodies

Reverse primer used for the amplification of heavy chain variable regions Reverse primer used for the amplification of κ light chain variable regions
 R1: AGGATCCAGGRRCCARKGGATAGACAGATG R2: AGGAGATGGTGGGAAGATGGATACAGTTG
Degenerate primer used for the amplification of heavy chain variable regions Degenerate primer used for the amplification of κ light chain variable regions
hF: κF:
 1. GCCCGTTTCTGCTAGC ATGTTGGTSCTGMAGTKGGTTTTSGTG 1. GCAATCCAGGTCCA ATGAAAATGACGACACCTGCTCAGTTC
 2. GCCCGTTTCTGCTAGC ATGAGACTACTAGGTCTTCTCCTGTGC 2. GCAATCCAGGTCCA ATGAGGGCCCCTTTTCAGTTACTTGGG
 3. GCCCGTTTCTGCTAGC ATGGGATGGAGCCAGATCATCCTCTTT 3. GCAATCCAGGTCCA ATGTCTAAAAACTTATTAGAAGTTTCA
 4. GCCCGTTTCTGCTAGC ATGGTTTTCGGGCTGATCCTTTTTCTT 4. GCAATCCAGGTCCA ATGGTAAGTCCTGCCCAGTTCCTGTTT
 5. GCCCGTTTCTGCTAGC ATGATGGGTTTAGGGGTGATTCTTTTT 5. GCAATCCAGGTCCA ATGATGGCTGCAGTTCAACTCTTAGGG
 6. GCCCGTTTCTGCTAGC ATGGGATTGAGCTGGGTTTTTCTTGTT 6. GCAATCCAGGTCCA ATGAAAGTGCCTGGTAGGCTGCTGGTG
 7. GCCCGTTTCTGCTAGC ATGGACTTGCGACTGACTTATGTCTTT 7. GCAATCCAGGTCCA ATGAAGTGGCTGTTAGTCTGTTGGTGC
 8. GCCCGTTTCTGCTAGC ATGACTATCCTGGTGCTTCTCCTCTGT 8. GCAATCCAGGTCCA ATGATTCCTGCCCAGTTCCTGTTTCTG
 9. GCCCGTTTCTGCTAGC ATGGCTRTCCTGGTGCTGTTGCTCTGC 9. GCAATCCAGGTCCA ATGATGAGTCCTGCCCAGTTCCTGTTT
 10. GCCCGTTTCTGCTAGC ATGRAATGSARCTGGRTCWTYYTCTTY 10. GCAATCCAGGTCCA ATGAATTTTCAGGTGCAGGTTTTTAGC
 11. GCCCGTTTCTGCTAGC ATGGCTGTCCTGGTGCTGTTGCTCTGC 11. GCAATCCAGGTCCA ATGAAYGTGYCCACTCAACTCCTTGGG
 12. GCCCGTTTCTGCTAGC ATGAGARYGYYGRKTCTTCTGTACCTG 12. GCAATCCAGGTCCA ATGGACATGAGGGCCCATRCTCAGTTT
 13. GCCCGTTTCTGCTAGC ATGGACWTCAGNCTCAGCTTGGBTTTC 13. GCAATCCAGGTCCA ATGARRKTYSNBVYTSAGYTTYKKGGG
 14. GCCCGTTTCTGCTAGC ATGRAGTTGDGSMTRANCTGGRTTTTY
Primer used for the amplification of heavy and light chains
 F3: CATCTGTCTATCCACTGGCTCCTGGAAC R3: TGACAGGTGCGCGTTTAGCACG TCATTTACCCGGAGAGTGGGAGAG
 F4: CGTGCTAAACGCGCACCTGTCAAAC R4: TGGACCTGGATTGCTTTCTACATC
 F5: CAACTGTATCCATCTTCCCACCATC R5: GATCCGGCCTTGCCGGC CCTAACACTCATTCCTGTTGAAG
  1. The primers used to amplify the heavy and κ light chain were designed using the genome sequence of the rat immunoglobulin: GenBank: DQ402471.1 for the κ light chain and GenBank: BC095846.1 for the heavy chain. Degenerate base code: M = A + C; R = A + G; W = A + T; S = C + G; Y = C + T; K = G + T; V = A + C + G; B = C + G + T; D = G + A + T; N = C + G + A + T