Skip to main content

Advertisement

Table 2 primers used in q-PCR experiments

From: Tristetraprolin specifically regulates the expression and alternative splicing of immune response genes in HeLa cells

Overexpression
 ZFP36-F CTGTCACCCTCTGCCTTCTC ZFP36-R TCCCAGGGACTGTACAGAGG
Differentially expressed genes
 IL23A-F TCGGTGAACAACTGAGGG IL23A-R TCAAATCTGGCTGGCTCT
 OASL-F AGGCTGATATGGAAAACC OASL-R CTGTAGGCAGGCACAATG
 TRIM22-F GGAACCTCCGACCTAATC TRIM22-R ACAAACCCAGCAAATGAC
 IFIT2-F ATACATACCAAACAATGCCTAC IRIT2-R GAGCCACAGCGTGTCCTA
 HERC5-F GTGGAGAAATTGGGTATG HERC5-R TTAGGCTTGACAGGAAAC
 IFIT3-F ACACCAAACAATGGCTAC IRIT3-R AGGATTCAGTCCCTTCTC
 TNF-F CTCACATACTGACCCACG TNR-R AAGAGGCTGAGGAACAAG
 IL6-F CAGACAGCCACTCACCTC IL6-R CTCTTTGCTGCTTTCACA
 CCL2-F GAAAACTGAGGCACCAAG CCL2-R GGAGCTAGAGGAGGAACG
 RelB-F CCACGCCTGGTGTCTCGC RelB-R CGCTGCTTGGGCTGCTCC
 CXCL2-F CTGCGCTGCCAGTGCTTG CXCL2-R GCTTTCTGCCCATTCTTG
 TRAF1-F GGACCGTCAGCCTCTTCT TRAR1-R GCGCATCATACTCCCCTC
 DDX58-F CAGTGTATGAACAGCAGA DDX58-R GATGGATAGTGATGGAAT
 B2M-F GGTTTCATCCATCCGACATT B2M-R ACGGCAGGCATACTCATCTT
 GDF15-F CTTGTTAGCCAAAGACTGCC GDF15-R AACCTTGAGCCCATTCCACA
 SLC6A12-F GTGACACTCCCTTGGCTGGTG SLC6A12-R GCCTTCTTCATCCCCTACTT
 HPV18-E6-F ATAAGGTGCCTGCGGTGCC HPV18-E6-R TGCGTCGTTGGAGTCGTTC
 HPV18-E7-F GAGCACGACAGGAACGACT HPV18-E7-R GGGCTGGTAAATGTTGATGAT
 HPV18-L1-F CAGGTGGTGGCAATAAGCAGGA HPV18-L1-F TGGCGGCATGGGAACTTTCAG
 GAPDH-F GGTCGGAGTCAACGGATTTG GAPDH-R GGAAGATGGTGATGGGATTTC
Alternative splicing events
 TRIM38 AS1-F TCGCCTCTGCTTATTCTA AS1/AS2-R CTTGATGACTCCTTAACATT
AS2-F CTTTGAGCAGGAGTTGGGCT
 IRF3 AS1/AS2-F GAAATCCTCCTGCTGTGCATC AS1-R GACGCTGGAGGCCGGACCAT
AS2-R TCCATCGTAGGCCGGACCAT
 TLR4 AS1/AS2-F GGTCAGACGGTGATAGCG AS1-R TAGGAACCACCTCCACGCAG
AS2-R TGTGGTTTAGGGCCAAGT
 LTBR AS1/AS2-F ACAAGCAAACGGAAGACC AS1-R CTGTGAGCCTCTTTGAGCTC
AS2-R GAGCTGCCTCCACCAGAC
 NOD1 AS1 -F GTTGTATAAACTTCAAGAGA AS1/AS2-R AAGGTGCTAAGCGAAGAG
AS2-F ATCCAGGATTTTGGTGAC
 CASP8 AS1/AS2-F CCTGCTGGATATTTTCAT AS1-R AACTCCTCCCCTTTGCTG
AS2-R CTTCAAGGCTGCTGCTTC
 MEF2A AS1/AS2-F GTAGCCCTTGGACTAGAAG AS1-R CCCAACCATTCTGTCCTATG
AS2-R TTCTTAAAGTCTGTCGGTTC
 MAP2K7 AS1/AS2-F CGGCGGCTCGACGGGGTC AS1 -R GGGCAGGAGCAGGGCTTAGAG
AS2-R AGCTGCAGGGTGGGCCTGGG
 ATF2 AS1/AS2-F CTGAAGCTTTCTTGAATTCATTCTC AS1-R ATGTGGCCAGATCAGACCCC
AS2-R GATCATTTGGCTGTCCATAAAC
 FLNA AS1/AS2-F CTACTCATTTTGAGGCGCGAGAAGC AS1-R GACCAGAAGGACAACTTCAAGCCCG
AS2-R GGAACAGCAGCGCAACCTCT
 KANK1 AS1/AS2-F TTCCATCCTCTTCAGTTG AS1-R CTTCGTGTTTAAAGCCCTC
AS2-R GGCATTCAACCTCTCAACAA
 SLC44A2 AS1-F CAGTGCCTCCCTCCAG AS1/AS2-R TTGTAAATGGGTCCTTTG
AS2-F CGGCCATGGAGGACGAGC
 CARHSP1 AS1-F ACAGCAAGTTAAAAAACAGTAGC AS1/AS2-R GGAAGCCTCCGGCCCTAT
AS2-F CATGGCTGACGTGTCTCCCG
 CREM AS1/AS2-F GGTCGGGCTCGCCGTCTC AS1 -R CACCACTTACCCGCCGCAAA
AS2-R AAGTTGGCATGTCACCAG
 TEAD2 AS1/AS2-F CTGGAGGATGGTGAAGTTTTCC AS1-R TTCCTCCAAGACGGAACGGG
AS2-R GGCAAGCAGGTGGTGGAG
 MYCBP2 AS1/AS2-F CTGAATGGTGAAATCCAC AS1 -R GAAGGAAGAGATGGAAGTGG
AS2-R TAAACGGGACAAGCACAAAG