Skip to main content

Table 1 primer sequences used in this study

From: Progranulin inhibits LPS-induced macrophage M1 polarization via NF-кB and MAPK pathways

Gene Full name Forward (5′-3′) Reverse (5′-3′)
TNF-α
iNOS
PGRN
Tumor necrosis factor-α
Inducible nitric oxide synthase
Progranulin
GCCTCTTCTCATTCCTGCTTG
TGGAGCCAGTTGTGGATTGTC
CCTGGTTCACACACGATGCG
GGCCATTTGGGAACTTCTCA
GGTCGTAATGTCCAGGAAGTAG
CAGGTGGTCGGAACAGCAGA