Skip to main content

Table 1 Primer sequence

From: The role of CXCR3 and its ligands expression in Brucellar spondylitis

Gene name Sequence Genebank
IFN-γ
 Forward CTAATTATTCGGTAACTGACTTGA NM_000619.3
 Reverse ACAGTTCAGCCATCACTTGGA  
CXCR3
 Forward ATGCGAGAGAAGCAGCCTTT NM_001142797
 Reverse TCCTATAACTGTCCCCGCCA  
CXCL9
 Forward GAAGCAGCCAAGTCGGTTAGTG NM_002416.2
 Reverse AATCATCAGCAGTGTGAGCAGTG  
CXCL10
 Forward TGGCATTCAAGGAGTACCTC NM_001565.3
 Reverse TTGTAGCAATGATCTCAACACG  
GAPDH
 Forward CATCCACTGGTGCTGCCAAGGCTGT NM_001289745.2
 Reverse ACAACCTGGTCCTCAGTGTAGCCCA  
  1. Abbreviations: IFN-γ interferon-gamma, CXCR3 CXC chemokine receptor 3, CXCL9 C-X-C motif chemokine ligand 9, CXCL10 C-X-C motif chemokine ligand 10