Skip to main content

Table 2 Candidate reference gene primers and details

From: Reliable reference genes for the quantification of mRNA in human T-cells and PBMCs stimulated with live influenza virus

SymbolPrimer and Probe Sequences (5′-3′)ExonsAverage Efficiency (%)a
ACTBF: ACAGAGCCTCGCCTTTG
R: CCTTGCACATGCCGGAG
P: /5HEX/TCATCCATG/ZEN/GTGAGCTGGCGG/3IABkFQ/
1–299.5
GAPDHF: ACATCGCTCAGACACCATG
R: TGTAGTTGAGGTCAATGAAGGG
P: /5HEX/AAGGTCGGA/ZEN/GTCAACGGATTTGGTC/3AIBkFQ/
2–396.8
RPL13aF: GCCGCCCCTGTTTCAAG
R: CTCGACCATCAAGCACCAG
P: /5HEX/AGAAACCCT/ZEN/GCGACAAAACCTCCT/3IABkFQ/
1b-399.3
RPS18F: GTTCCAGCATATTTTGCGAGT
R: GTCAATGTCTGCTTTCCTCAAC
P: /5HEX/TCTTCGGCC/ZEN/CACACCCTTAATGG/3IABkFQ/
2–399.5
SDHAF: TTTGATGCAGTGGTGGTAGG
R: CAGAGCAGCATTGATTCCTC
P: /5HEX/TGCAACAGT/ZEN/GTGTGACCTGGTAGG/3IABkFQ/
3–499.5
UBE2D2F: GTACTCTTGTCCATCTGTTCTCTG
R: CCATTCCCGAGCTATTCTGTT
P: /5HEX/CCGAGCAAT/ZEN/CTCAGGCACTAAAGGA/3IABkFQ/
6–899.3
  1. a Average efficiencies were calculated from both unstimulated PBMC and T-cell samples