Skip to main content

Table 1 Primers used for real time PCR analysis

From: Anti-inflammatory protein TNFα-stimulated gene-6 (TSG-6) reduces inflammatory response after brain injury in mice

Gene (Mus musculus) Accession number Forward (5’ → 3’) Reverse (5’ → 3’)
Tenascin C (tnc) NM_011607.3 CCAGGGTTGCCACCTATTT GTCTAGAGGATCCCACTCTACTT
Gfap NM_001131020.1 AACAACCTGGCTGCGTATAG TCTCGAACTTCCTCCTCATAGAT
Tsg-6 /Tnfaip6 NM_009398.2 CCCACATGCAAAGGAGTGTG TGAGCCGAATGTGCCAGTAG
Chst1 NM_021439.2 CACCCAGTCATGCGGAGGAA GCAGGATGGCAGTGTTGGAT
Chst12 NM_021528.3 GAGCTGGAGAACGAAGAGTTT CAGGAGGTACTGGATGAAGTTG
IL1β NM_008361.4 GTGCAAGTGTCTGAAGCAGC CTCATCACTGTCAAAAGGTGGC
Cspg4 NM_139001.2 TCTACAGCTCCTGCCTCCTT ATGTGGAGAACTGGAGCAGC
Ccl5 (Rantes) NM_013653.3 CCTCACCATATGGCTCGGAC ACGACTGCAAGATTGGAGCA
Nfkb1 NM_008689.2 GTCACCCATGGCACCATAAA CCTTCACCTTCAGTTTCCTTCTC
Has1 NM_008215.2 CTA TGC TAC CAA GTA TAC CTC G TCT CGG AAG TAA GAT TTG GAC
Has2 NM_008216.3 CGG TCG TCT CAA ATT CAT CTG ACA ATG CAT CTT GTT CAG CTC
Has 3 NM_008217.4 GAT GTC CAA ATC CTC AAC AAG CCC ACT AAT ACA TTG CAC AC
Itih1   CCA CCC CAT CGG TTT TGA AGT GTC T TGC CAC GGG TCC TTG CTG TAG TCT
Itih2   ATG AAA AGA CTC ACG TGC TTT TTC ATT TGC CTG GGG CCA GT
Itih3   TGA GGA GGT GGC CAA CCC ACT CGC TTC TCC AGC AGC TGC TC
Actb NM_007393.5 CACTGTCGAGTCGCGTCC TCATCCATGGCGAACTGGTG
Gapdh NM_001289726.1 AACAGCAACTCCCACTCTTC CCTGTTGCTGTAGCCGTATT