Open Access

Bacillus anthracis’ lethal toxin induces broad transcriptional responses in human peripheral monocytes

  • Kassidy M Chauncey1,
  • M Cecilia Lopez2,
  • Gurjit Sidhu1,
  • Sarah E Szarowicz1,
  • Henry V Baker2,
  • Conrad Quinn3 and
  • Frederick S Southwick1Email author
BMC Immunology201213:33

DOI: 10.1186/1471-2172-13-33

Received: 29 November 2011

Accepted: 18 April 2012

Published: 2 July 2012

Abstract

Background

Anthrax lethal toxin (LT), produced by the Gram-positive bacterium Bacillus anthracis, is a highly effective zinc dependent metalloprotease that cleaves the N-terminus of mitogen-activated protein kinase kinases (MAPKK or MEKs) and is known to play a role in impairing the host immune system during an inhalation anthrax infection. Here, we present the transcriptional responses of LT treated human monocytes in order to further elucidate the mechanisms of LT inhibition on the host immune system.

Results

Western Blot analysis demonstrated cleavage of endogenous MEK1 and MEK3 when human monocytes were treated with 500 ng/mL LT for four hours, proving their susceptibility to anthrax lethal toxin. Furthermore, staining with annexin V and propidium iodide revealed that LT treatment did not induce human peripheral monocyte apoptosis or necrosis. Using Affymetrix Human Genome U133 Plus 2.0 Arrays, we identified over 820 probe sets differentially regulated after LT treatment at the p <0.001 significance level, interrupting the normal transduction of over 60 known pathways. As expected, the MAPKK signaling pathway was most drastically affected by LT, but numerous genes outside the well-recognized pathways were also influenced by LT including the IL-18 signaling pathway, Toll-like receptor pathway and the IFN alpha signaling pathway. Multiple genes involved in actin regulation, signal transduction, transcriptional regulation and cytokine signaling were identified after treatment with anthrax LT.

Conclusion

We conclude LT directly targets human peripheral monocytes and causes multiple aberrant gene responses that would be expected to be associated with defects in human monocyte’s normal signaling transduction pathways and function. This study provides further insights into the mechanisms associated with the host immune system collapse during an anthrax infection, and suggests that anthrax LT may have additional downstream targets outside the well-known MAPK pathway.

Background

Bacillus anthracis, the causative agent of anthrax, is a gram-positive bacterium that is naturally found in the soil, and rarely affects the human population. Unfortunately, deliberate dissemination of anthrax spores is capable of delivering a highly potent and lethal air-borne bioterrorist agent, as documented in the 2001 U.S. anthrax attacks. Inhalation anthrax is a highly fatal, acute disease characterized by a rapid onset of systemic shock and ultimately death[1].

The most virulent strains of B. anthracis contain two plasmids, pXO2 and pXO1, encoding an antiphagocytic poly-D-glutamic acid capsule and three exotoxins: lethal factor, edema factor and protective antigen[2]. Protective antigen is an 83 kDa protein that is known to bind to two host cell receptors, TEM-8 and CMG-2, facilitating the entry of edema and/or lethal factor into host cells[3]. Lethal factor is a 90 kDa zinc-dependent metalloprotease that cleaves the N-terminus of mitogen-activated protein kinase kinases (MAPKKs or MEKs)[4, 5]. Edema factor is an 89 kDa adenylate cyclase that increases intracellular cAMP levels[6].

Previous studies using anthrax animal models have documented resistance to anthrax lethal toxin (LT) through depletion of host macrophages, suggesting that these cells play a critical role in anthrax LT induced lethality[7, 8]. LT has also been shown to suppress cytokine responses by peripheral blood mononuclear cells, induce macrophage apoptosis, and prevent monocyte proliferation and differentiation[1, 9, 10]. Inhalation anthrax cases present clinical manifestations indicative of host immune collapse in humans and in nonhuman primate studies[1113]. However, more recent studies investigating human monocytes and macrophages have suggested human alveolar macrophages are resistant to LT, and undifferentiated human monocytic cell lines are resistant to LT-induced death[10, 14]. LT’s targeting of human monocytes/macrophages could help to explain the rapid onset of fatal symptoms and host demise during an inhalation anthrax infection, but the exact effects LT exerts on human peripheral monocytes, along with the mechanisms underlying the impairment of the host immune cell’s responses, have yet to be fully determined.

Previous studies investigating LT treated murine macrophages have shown a broad range in transcriptional effects induced by LT. These studies concluded LT-induced changes in macrophage inflammation, signaling, and transcription factors, along with changes in the immune response by macrophages. This study discovered the down regulation of CD-137 after LT treatment, shown to play a role in monocyte proliferation in response to LPS, and up regulation of plasminogen activator inhibitor type I, which results in fibrin deposits, massive imbalances in coagulation, and, in some instances, multi-organ failure[15, 16]. Another study has measured the transcriptional responses of THP-1 cells after B. anthracis spore exposure, finding toxigenic B. anthracis strains suppress the cell signaling responses to infection[17].

Blood monocytes are mononuclear cells that play a major role in the host immune response through regulation of inflammatory responses, secretion of cytokine and antimicrobial factors, and direct pathogen clearance[18]. Monocytes are derived from monoblasts in the bone marrow, and circulate in the blood for 1-2 days before they migrate into tissues where they replenish the macrophage and dendritic pools[1921]. Here, we determined human monocyte susceptibility to LT by demonstrating cleavage of MEKs, and utilized Affymetrix GeneChip® Human Genome U133 Plus 2.0 Arrays in order to identify additional mechanisms of LT impairment on the transcriptional responses of human peripheral monocytes. The arrays contained 54,675 probe sets representing over 22,000 of the best characterized human genes, providing extensive insights into the mechanisms behind LT induced dysfunction of human peripheral monocytes.

This study is the first to determine direct human monocyte susceptibility via cleavage of MEKs, along with the analysis of the transcriptional responses, to anthrax LT. The mechanisms of LT impairment on human peripheral monocytes will help elucidate the roles monocytes contribute during the host immune system collapse documented during an anthrax infection. The transcriptional analysis will serve to not only unravel the mechanisms behind the rapid onset of death in anthrax victims, but will also potentially provide new targets for controlling inflammation and enhancing host defense.

Results and discussion

Monocyte purity, apoptosis and susceptibility to anthrax LT

In order to first determine monocyte cell purity, isolated cells were analyzed using flow cytometry and gated using forward and side scatter, along with the monocytic marker, CD14. It was found that monocytes were isolated with a >85% purity (Figure 1A and1B). Because previous reports have documented LT induced cell apoptosis, it was important to assure the transcriptional response of LT treated monocytes were independent of apoptosis. This was assured by the analysis of the necrosis and apoptosis markers, propidium iodide (PI) and annexin V, on human peripheral monocytes. Nearly all (99%) human peripheral monocytes showed no evidence of necrosis or apoptosis after a 4 h treatment of LT (Figure 1C and1D). There has been some conflicting data suggesting monocytes, along with monocyte-derived cells, are not susceptible to the actions of anthrax LT. One study utilized human monocytic cell lines and found that undifferentiated monocytic cells did not undergo LT-induced cytotoxicity, while the differentiated cells were susceptible[10]. Another study investigating human alveolar macrophages (AM) found that these cells were relatively resistant to the actions of LT. It was ascertained that LT failed to suppress human AM cytokine responses, cleave MEKs, and induce apoptosis[14].
https://static-content.springer.com/image/art%3A10.1186%2F1471-2172-13-33/MediaObjects/12865_2011_Article_459_Fig1_HTML.jpg
Figure 1

Monocyte purity, apoptosis, and susceptibility to LT. Red = CD14+ monocytes. Green = CD14-lymphocytes. A.) Forward and side scatter analysis of purified fixed human monocytes showing the monocyte population as compared to total population. B.) CD14 Pacific Blue and forward scatter analysis of fixed purified human monocytes showing >85% monocytes. C.) PI and annexin-FITC analysis of CD14 + monocytes after a 4 h incubation showing 99.0% viable cells indicated in quadrant 3. D.) PI and annexin-FITC analysis of CD14 + monocytes after a 4 h LT treatment showing 99.1% viable cells indicated in quadrant 3. HeLa cells or human monocytes were left untreated or treated with 500 ng/mL LT for 4 h at 37°C. Samples were lysed, run on SDS-PAGE, transferred to PVDF membrane, and probed with indicated antibodies. Both MEK3 and MEK1 were cleaved by LT while control cells showed no MEK cleavage. β-actin loading controls show equivalent loading of both control and LT treated cells.

In order to explore the actions of LT on human peripheral monocytes, a Western Blot analysis was performed and MEK1, along with MEK3, cleavage was determined after a 4-hour treatment with LT. Human peripheral monocytes were found to be susceptible to the actions of LT as evidenced by cleavage of MEK1 and MEK3 (Figure 1E). HeLa cells were used as a positive control and β-actin was used to assure equal loading controls. We conclude that human peripheral monocytes are a direct target of anthrax LT.

Microarray analysis and results

Human peripheral monocytes were treated with LT or media alone, and microarray analysis was performed using four biological replicates from healthy volunteers. A total of 8 microarray hybridizations were employed and analyzed on Affymetrix Gene Chips®(HG U133 plus 2.0). The chips contained 54,675 probe sets and identified multiple differentially regulated pathways and genes by human peripheral monocytes after LT treatment. Unsupervised hierarchical analysis was used to assess the noise in the array experiments. First, probe sets whose signal intensity varied most in the data set were selected by applying a variation filter. Probes sets that displayed a coefficient of variation of greater than 0.5 were subjected to hierarchical analysis. The clustering dendrogram showed the major node of separation between control and LT treated samples (Figure 2A).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2172-13-33/MediaObjects/12865_2011_Article_459_Fig2_HTML.jpg
Figure 2

Unsupervised microarray analysis. A.) Hierarchical clustering dendrogram showing similarities between expression patterns within each condition. Specimens were paired based on donor, using 4 separate donors as indicated in replica r1 through r4. B.) Significant genes (p < 0.001) up or down regulated after LT treatment, along with their fold change, p-value and probe ID. C.) Leave-one-out-cross validation was used to calculate mis-classification rate that yielded a 100% correct classification between pairs.

To identify specific genes responsive to LT treatment, a paired t-test (by donor) was performed at a significance threshold of p < 0.001. Genes specified by 820 probe sets were found to be significant among the treatment groups (Table 1). The hierarchical cluster pattern of the significant probe sets is shown (Figure 3A). Of these probe sets, multiple gene products known to play a role in monocyte function were discovered (Figure 2B). The ability of probe sets significant at p < 0.001 to function as a classifier between treatment groups (LT treated vs. control) was established by leave-one-out-cross-validation and Monte Carlo simulations. Using 4 different prediction models, the classifier performed flawlessly. Of the significant genes identified, many are known to play a role in monocyte function (Figure 2C).
Table 1

Control vs Toxin corresponding P-value p<0.001

 

Paramet. p-value

Geometric mean of intensities

Probe set

Gene symbol

Description

1

2.80E-006

1.78

222001_x_at

FAM91A2

family with sequence similarity 91, member A2

2

2.90E-006

1.25

218734_at

NAT11

N-acetyltransferase 11

3

3.40E-006

1.6

230350_at

NA

NA

4

7.80E-006

1.56

228930_at

NA

NA

5

8.70E-006

1.58

208661_s_at

TTC3

tetratricopeptide repeat domain 3

6

9.80E-006

1.16

218716_x_at

MTO1

mitochondrial translation optimization 1 homolog (S. cerevisiae)

7

1.07E-005

1.15

238538_at

ANKRD11

ankyrin repeat domain 11

8

1.22E-005

2.92

225896_at

NA

NA

9

1.41E-005

3.87

227450_at

ERP27

endoplasmic reticulum protein 27 kDa

10

1.49E-005

1.23

226602_s_at

BCR

breakpoint cluster region

11

1.60E-005

1.65

209123_at

QDPR

quinoid dihydropteridine reductase

12

1.66E-005

1.73

213934_s_at

ZNF23

zinc finger protein 23 (KOX 16)

13

1.66E-005

1.56

226419_s_at

SFRS1

splicing factor, arginine/serine-rich 1

14

1.84E-005

2.91

227946_at

OSBPL7

oxysterol binding protein-like 7

15

2.04E-005

1.84

242989_at

NA

NA

16

2.18E-005

1.92

242590_at

NA

NA

17

2.29E-005

1.36

204559_s_at

LSM7

LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)

18

2.35E-005

1.68

225902_at

NA

NA

19

2.44E-005

1.29

220939_s_at

DPP8

dipeptidyl-peptidase 8

20

2.63E-005

1.2

218682_s_at

SLC4A1AP

solute carrier family 4 (anion exchanger), member 1, adaptor protein

21

2.72E-005

2.21

212056_at

KIAA0182

KIAA0182

22

2.91E-005

2.87

222477_s_at

TM7SF3

transmembrane 7 superfamily member 3

23

3.01E-005

2.01

202512_s_at

ATG5

ATG5 autophagy related 5 homolog (S. cerevisiae)

24

3.07E-005

1.52

209042_s_at

UBE2G2

ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)

25

3.10E-005

5.25

232181_at

LOC153346

hypothetical protein LOC153346

26

3.13E-005

1.79

1554452_a_at

HIG2

hypoxia-inducible protein 2

27

3.36E-005

2.11

228772_at

HNMT

histamine N-methyltransferase

28

3.37E-005

1.3

221501_x_at

LOC339047

hypothetical protein LOC339047

29

3.39E-005

1.81

239038_at

C1orf52

chromosome 1 open reading frame 52

30

3.46E-005

1.95

203839_s_at

TNK2

tyrosine kinase, non-receptor, 2

31

3.89E-005

1.89

227558_at

CBX4

chromobox homolog 4 (Pc class homolog, Drosophila)

32

3.90E-005

1.4

214691_x_at

FAM63B

family with sequence similarity 63, member B

33

3.91E-005

1.32

228301_x_at

NDUFB10

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa

34

4.05E-005

1.8

1556306_at

NA

NA

35

4.22E-005

3.27

229016_s_at

TRERF1

transcriptional regulating factor 1

36

4.47E-005

3.85

223741_s_at

TTYH2

tweety homolog 2 (Drosophila)

37

4.48E-005

5.6

49306_at

RASSF4

Ras association (RalGDS/AF-6) domain family member 4

38

4.63E-005

1.49

32209_at

FAM89B

family with sequence similarity 89, member B

39

4.75E-005

2.83

225298_at

PNKD

paroxysmal nonkinesigenic dyskinesia

40

5.00E-005

1.59

228726_at

NA

NA

41

5.36E-005

1.17

1562984_at

NA

NA

42

5.39E-005

1.6

201639_s_at

CPSF1

cleavage and polyadenylation specific factor 1, 160kDa

43

5.66E-005

1.47

221649_s_at

PPAN

peter pan homolog (Drosophila)

44

5.88E-005

1.94

225360_at

TRABD

TraB domain containing

45

6.23E-005

1.27

221005_s_at

PTDSS2

phosphatidylserine synthase 2

46

6.35E-005

2.13

228914_at

NA

NA

47

6.47E-005

1.65

208206_s_at

RASGRP2

RAS guanyl releasing protein 2 (calcium and DAG-regulated)

48

6.49E-005

1.64

209198_s_at

SYT11

synaptotagmin XI

49

6.55E-005

1.7

221575_at

SCLY

selenocysteine lyase

50

6.74E-005

1.82

229969_at

NA

NA

51

6.76E-005

2.22

235513_at

NA

NA

52

6.77E-005

1.93

236922_at

NA

NA

53

6.78E-005

1.14

204364_s_at

REEP1

receptor accessory protein 1

54

6.87E-005

1.55

227025_at

PPHLN1

periphilin 1

55

7.02E-005

1.78

227288_at

SFRS12IP1

SFRS12-interacting protein 1

56

7.13E-005

2.55

205075_at

SERPINF2

serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2

57

7.16E-005

2.29

222988_s_at

TMEM9

transmembrane protein 9

58

7.35E-005

1.39

231831_at

COX19

COX19 cytochrome c oxidase assembly homolog (S. cerevisiae)

59

7.37E-005

1.88

221788_at

NA

NA

60

7.66E-005

1.61

236004_at

NA

NA

61

7.68E-005

1.85

219751_at

SETD6

SET domain containing 6

62

7.92E-005

1.74

227273_at

NA

NA

63

8.67E-005

1.56

235787_at

NA

NA

64

8.91E-005

1.42

212888_at

DICER1

dicer 1, ribonuclease type III

65

8.93E-005

1.93

1568593_a_at

NUDT16P

nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene

66

9.00E-005

1.92

226721_at

DPY19L4

dpy-19-like 4 (C. elegans)

67

9.02E-005

1.39

227159_at

GHDC

GH3 domain containing

68

9.14E-005

2.36

225982_at

UBTF

upstream binding transcription factor, RNA polymerase I

69

9.25E-005

1.62

220341_s_at

C5orf45

chromosome 5 open reading frame 45

70

9.51E-005

1.36

214501_s_at

H2AFY

H2A histone family, member Y

71

9.96E-005

7.6

226186_at

NA

NA

72

0.0001001

2.59

224946_s_at

CCDC115

coiled-coil domain containing 115

73

0.0001056

1.66

237059_at

NA

NA

74

0.0001076

3.11

38671_at

PLXND1

plexin D1

75

0.0001083

1.92

231912_s_at

DKFZP434B0335

DKFZP434B0335 protein

76

0.0001087

1.55

238492_at

NA

NA

77

0.0001088

2.05

228548_at

NA

NA

78

0.0001089

1.9

225757_s_at

CLMN

calmin (calponin-like, transmembrane)

79

0.0001093

1.15

203926_x_at

ATP5D

ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit

80

0.0001100

1.41

232520_s_at

NSFL1C

NSFL1 (p97) cofactor (p47)

81

0.0001101

2.06

238012_at

DPP7

dipeptidyl-peptidase 7

82

0.0001101

1.38

211101_x_at

LILRA2

leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2

83

0.0001109

1.35

210128_s_at

LTB4R

leukotriene B4 receptor

84

0.0001115

1.34

223393_s_at

TSHZ3

teashirt zinc finger homeobox 3

85

0.0001123

1.46

213628_at

CLCC1

chloride channel CLIC-like 1

86

0.0001152

1.27

214870_x_at

LOC100132540

similar to LOC339047 protein

87

0.0001171

2.41

221756_at

PIK3IP1

phosphoinositide-3-kinase interacting protein 1

88

0.0001171

1.62

222478_at

VPS36

vacuolar protein sorting 36 homolog (S. cerevisiae)

89

0.0001192

1.99

225719_s_at

MRPL55

mitochondrial ribosomal protein L55

90

0.0001206

1.87

212959_s_at

GNPTAB

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

91

0.0001210

7.64

238520_at

TRERF1

transcriptional regulating factor 1

92

0.0001235

3.04

226974_at

NA

NA

93

0.0001269

2.06

225851_at

FNTB

farnesyltransferase, CAAX box, beta

94

0.0001288

2.04

224452_s_at

MGC12966

hypothetical protein LOC84792

95

0.0001306

1.46

226092_at

MPP5

membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)

96

0.0001312

1.5

1558693_s_at

C1orf85

chromosome 1 open reading frame 85

97

0.0001336

1.19

204020_at

PURA

purine-rich element binding protein A

98

0.0001350

1.73

1555882_at

SPIN3

spindlin family, member 3

99

0.0001354

1.8

235532_at

PIGM

phosphatidylinositol glycan anchor biosynthesis, class M

100

0.0001371

2.61

1553111_a_at

KBTBD6

kelch repeat and BTB (POZ) domain containing 6

101

0.0001408

1.44

227868_at

LOC154761

hypothetical LOC154761

102

0.0001408

3.15

214058_at

MYCL1

v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian)

103

0.0001409

2.65

212686_at

PPM1H

protein phosphatase 1H (PP2C domain containing)

104

0.0001414

1.61

218971_s_at

WDR91

WD repeat domain 91

105

0.0001418

2.07

225777_at

C9orf140

chromosome 9 open reading frame 140

106

0.0001426

1.92

225366_at

PGM2

phosphoglucomutase 2

107

0.0001451

1.74

238768_at

C2orf68

chromosome 2 open reading frame 68

108

0.0001454

1.49

218674_at

C5orf44

chromosome 5 open reading frame 44

109

0.0001462

1.26

218490_s_at

ZNF302

zinc finger protein 302

110

0.0001537

1.17

202704_at

TOB1

transducer of ERBB2, 1

111

0.0001561

1.69

218361_at

GOLPH3L

golgi phosphoprotein 3-like

112

0.0001565

1.32

222994_at

PRDX5

peroxiredoxin 5

113

0.0001590

2.19

209828_s_at

IL16

interleukin 16 (lymphocyte chemoattractant factor)

114

0.0001593

1.47

204611_s_at

PPP2R5B

protein phosphatase 2, regulatory subunit B@#$%&, beta isoform

115

0.0001593

1.48

227730_at

NA

NA

116

0.0001599

1.14

228605_at

NA

NA

117

0.0001646

1.54

202135_s_at

ACTR1B

ARP1 actin-related protein 1 homolog B, centractin beta (yeast)

118

0.0001669

1.73

226183_at

NA

NA

119

0.0001709

1.88

65472_at

C2orf68

chromosome 2 open reading frame 68

120

0.0001738

1.57

200098_s_at

ANAPC5

anaphase promoting complex subunit 5

121

0.0001748

1.37

218181_s_at

MAP4K4

mitogen-activated protein kinase kinase kinase kinase 4

122

0.0001762

2.81

238135_at

AGTRAP

angiotensin II receptor-associated protein

123

0.0001767

3.66

203386_at

TBC1D4

TBC1 domain family, member 4

124

0.0001784

2.06

213670_x_at

NSUN5B

NOL1/NOP2/Sun domain family, member 5B

125

0.0001787

1.69

212109_at

HN1L

hematological and neurological expressed 1-like

126

0.0001789

1.85

219968_at

ZNF589

zinc finger protein 589

127

0.0001799

2.25

211495_x_at

TNFSF13

tumor necrosis factor (ligand) superfamily, member 13

128

0.0001836

2.07

214177_s_at

PBXIP1

pre-B-cell leukemia homeobox interacting protein 1

129

0.0001843

1.64

1554085_at

DDX51

DEAD (Asp-Glu-Ala-Asp) box polypeptide 51

130

0.0001852

1.99

203271_s_at

UNC119

unc-119 homolog (C. elegans)

131

0.0001878

1.43

226072_at

FUK

fucokinase

132

0.0001878

3.32

212235_at

PLXND1

plexin D1

133

0.0001902

1.67

205658_s_at

SNAPC4

small nuclear RNA activating complex, polypeptide 4, 190kDa

134

0.0001983

1.84

218021_at

DHRS4

dehydrogenase/reductase (SDR family) member 4

135

0.0001987

1.76

229429_x_at

FAM91A2

family with sequence similarity 91, member A2

136

0.0001990

1.27

212429_s_at

GTF3C2

general transcription factor IIIC, polypeptide 2, beta 110kDa

137

0.0002007

1.81

226873_at

NA

NA

138

0.0002010

1.31

227801_at

TRIM59

tripartite motif-containing 59

139

0.0002032

1.36

227679_at

NA

NA

140

0.0002081

4.03

218326_s_at

LGR4

leucine-rich repeat-containing G protein-coupled receptor 4

141

0.0002087

1.93

235252_at

KSR1

kinase suppressor of ras 1

142

0.0002093

1.45

1558522_at

NA

NA

143

0.0002165

1.57

225396_at

NA

NA

144

0.0002167

1.4

206469_x_at

AKR7A3

aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)

145

0.0002197

1.79

1563549_a_at

ANO8

anoctamin 8

146

0.0002219

1.79

211576_s_at

SLC19A1

solute carrier family 19 (folate transporter), member 1

147

0.0002234

1.35

202846_s_at

PIGC

phosphatidylinositol glycan anchor biosynthesis, class C

148

0.0002246

2.17

232231_at

RUNX2

runt-related transcription factor 2

149

0.0002301

1.24

213480_at

VAMP4

vesicle-associated membrane protein 4

150

0.0002335

1.57

1558755_x_at

ZNF763

zinc finger protein 763

151

0.0002348

1.87

1557667_at

NA

NA

152

0.0002362

1.53

211036_x_at

ANAPC5

anaphase promoting complex subunit 5

153

0.0002367

2.73

203387_s_at

TBC1D4

TBC1 domain family, member 4

154

0.0002416

1.35

217896_s_at

NIP30

NEFA-interacting nuclear protein NIP30

155

0.0002420

2.35

212136_at

ATP2B4

ATPase, Ca++ transporting, plasma membrane 4

156

0.0002425

1.4

207618_s_at

BCS1L

BCS1-like (yeast)

157

0.0002450

1.85

239300_at

NA

NA

158

0.0002478

2.1

229497_at

ANKDD1A

ankyrin repeat and death domain containing 1A

159

0.0002509

1.29

214035_x_at

LOC399491

LOC399491 protein

160

0.0002517

1.66

229874_x_at

NA

NA

161

0.0002521

1.74

221264_s_at

LOC100128223

hypothetical protein LOC100128223

162

0.0002522

1.54

227630_at

NA

NA

163

0.0002531

2.4

226016_at

CD47

CD47 molecule

164

0.0002559

1.53

1558947_at

NA

NA

165

0.0002582

2.08

222664_at

KCTD15

potassium channel tetramerisation domain containing 15

166

0.0002606

4.49

207843_x_at

CYB5A

cytochrome b5 type A (microsomal)

167

0.0002633

2.1

218394_at

ROGDI

rogdi homolog (Drosophila)

168

0.0002634

1.86

214100_x_at

NSUN5B

NOL1/NOP2/Sun domain family, member 5B

169

0.0002641

1.4

212895_s_at

ABR

active BCR-related gene

170

0.0002648

2.01

227580_s_at

DKFZP434B0335

DKFZP434B0335 protein

171

0.0002678

2.59

227253_at

CP

ceruloplasmin (ferroxidase)

172

0.0002679

1.78

230917_at

NA

NA

173

0.0002686

1.69

200843_s_at

EPRS

glutamyl-prolyl-tRNA synthetase

174

0.0002686

2.67

227346_at

IKZF1

IKAROS family zinc finger 1 (Ikaros)

175

0.0002715

1.44

219095_at

LOC100137047-PLA2G4B

hypothetical protein LOC8681

176

0.0002762

1.68

229776_at

SLCO3A1

solute carrier organic anion transporter family, member 3A1

177

0.0002768

4.48

226436_at

RASSF4

Ras association (RalGDS/AF-6) domain family member 4

178

0.0002796

1.37

221951_at

TMEM80

transmembrane protein 80

179

0.0002809

1.49

228606_at

TM4SF19

transmembrane 4 L six family member 19

180

0.0002817

1.66

232535_at

NA

NA

181

0.0002826

1.28

1569597_at

NA

NA

182

0.0002831

1.77

1555845_at

NA

NA

183

0.0002835

2.77

205955_at

NA

NA

184

0.0002839

2.47

220137_at

FLJ20674

hypothetical protein FLJ20674

185

0.0002845

2.56

218459_at

TOR3A

torsin family 3, member A

186

0.0002870

1.73

238929_at

SFRS2B

splicing factor, arginine/serine-rich 2B

187

0.0002872

2.1

203317_at

PSD4

pleckstrin and Sec7 domain containing 4

188

0.0002969

1.32

238263_at

LOC285965

hypothetical protein LOC285965

189

0.0003005

2.64

235159_at

NA

NA

190

0.0003043

1.24

218388_at

PGLS

6-phosphogluconolactonase

191

0.0003057

1.3

206729_at

TNFRSF8

tumor necrosis factor receptor superfamily, member 8

192

0.0003121

1.28

231130_at

NA

NA

193

0.0003123

1.4

1552257_a_at

TTLL12

tubulin tyrosine ligase-like family, member 12

194

0.0003129

1.29

219175_s_at

SLC41A3

solute carrier family 41, member 3

195

0.0003162

1.41

204786_s_at

IFNAR2

interferon (alpha, beta and omega) receptor 2

196

0.0003176

1.47

225391_at

LOC93622

hypothetical LOC93622

197

0.0003216

1.35

227127_at

TMEM110

transmembrane protein 110

198

0.0003219

3.64

202341_s_at

TRIM2

tripartite motif-containing 2

199

0.0003243

2.09

210731_s_at

LGALS8

lectin, galactoside-binding, soluble, 8

200

0.0003251

1.77

213374_x_at

HIBCH

3-hydroxyisobutyryl-Coenzyme A hydrolase

201

0.0003260

1.38

200931_s_at

VCL

vinculin

202

0.0003264

1.45

230304_at

NA

NA

203

0.0003271

2.03

235195_at

FBXW2

F-box and WD repeat domain containing 2

204

0.0003290

4.23

215726_s_at

CYB5A

cytochrome b5 type A (microsomal)

205

0.0003300

2.01

242794_at

MAML3

mastermind-like 3 (Drosophila)

206

0.0003304

2.18

225961_at

KLHDC5

kelch domain containing 5

207

0.0003309

1.48

212556_at

SCRIB

scribbled homolog (Drosophila)

208

0.0003322

2.66

220494_s_at

NA

NA

209

0.0003337

2.38

242297_at

RREB1

ras responsive element binding protein 1

210

0.0003349

1.9

228771_at

ADRBK2

adrenergic, beta, receptor kinase 2

211

0.0003390

1.19

227465_at

KIAA0892

KIAA0892

212

0.0003390

1.37

228667_at

AGPAT4

1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)

213

0.0003408

1.72

202161_at

PKN1

protein kinase N1

214

0.0003417

1.32

AFFX-LysX-M_at

NA

NA

215

0.0003429

1.57

223314_at

TSPAN14

tetraspanin 14

216

0.0003438

2.51

204610_s_at

CCDC85B

coiled-coil domain containing 85B

217

0.0003438

2.03

218027_at

MRPL15

mitochondrial ribosomal protein L15

218

0.0003450

2.45

204718_at

EPHB6

EPH receptor B6

219

0.0003454

2.06

227313_at

CNPY4

canopy 4 homolog (zebrafish)

220

0.0003454

1.52

228600_x_at

C7orf46

chromosome 7 open reading frame 46

221

0.0003472

1.28

226335_at

RPS6KA3

ribosomal protein S6 kinase, 90kDa, polypeptide 3

222

0.0003481

1.48

219147_s_at

C9orf95

chromosome 9 open reading frame 95

223

0.0003492

1.41

219801_at

ZNF34

zinc finger protein 34

224

0.0003534

1.37

224865_at

FAR1

fatty acyl CoA reductase 1

225

0.0003534

1.25

209450_at

OSGEP

O-sialoglycoprotein endopeptidase

226

0.0003535

1.8

239016_at

NA

NA

227

0.0003567

1.44

228670_at

TEP1

telomerase-associated protein 1

228

0.0003600

1.87

210580_x_at

SULT1A3

sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3

229

0.0003607

1.38

213945_s_at

NUP210

nucleoporin 210kDa

230

0.0003644

1.32

218505_at

WDR59

WD repeat domain 59

231

0.0003661

2.32

230343_at

NA

NA

232

0.0003663

2.08

230888_at

WDR91

WD repeat domain 91

233

0.0003691

1.87

226368_at

CHST11

carbohydrate (chondroitin 4) sulfotransferase 11

234

0.0003691

1.67

213364_s_at

SNX1

sorting nexin 1

235

0.0003706

2.17

213626_at

CBR4

carbonyl reductase 4

236

0.0003712

1.45

AFFX-PheX-3_at

NA

NA

237

0.0003730

1.59

206567_s_at

PHF20

PHD finger protein 20

238

0.0003737

1.49

221090_s_at

OGFOD1

2-oxoglutarate and iron-dependent oxygenase domain containing 1

239

0.0003762

1.33

44040_at

FBXO41

F-box protein 41

240

0.0003796

2.03

226238_at

MCEE

methylmalonyl CoA epimerase

241

0.0003812

1.45

204562_at

IRF4

interferon regulatory factor 4

242

0.0003827

1.46

226241_s_at

MRPL52

mitochondrial ribosomal protein L52

243

0.0003831

1.46

220178_at

C19orf28

chromosome 19 open reading frame 28

244

0.0003841

1.31

209263_x_at

TSPAN4

tetraspanin 4

245

0.0003893

1.45

232228_at

ZNF530

zinc finger protein 530

246

0.0003907

2.04

208760_at

UBE2I

ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)

247

0.0003909

1.18

224562_at

WASF2

WAS protein family, member 2

248

0.0003923

1.63

213485_s_at

ABCC10

ATP-binding cassette, sub-family C (CFTR/MRP), member 10

249

0.0003984

1.13

202942_at

ETFB

electron-transfer-flavoprotein, beta polypeptide

250

0.0004011

1.54

AFFX-LysX-3_at

NA

NA

251

0.0004028

1.79

212135_s_at

ATP2B4

ATPase, Ca++ transporting, plasma membrane 4

252

0.0004062

1.24

217828_at

SLTM

SAFB-like, transcription modulator

253

0.0004150

2.05

212875_s_at

C2CD2

C2 calcium-dependent domain containing 2

254

0.0004182

2.92

1557411_s_at

SLC25A43

solute carrier family 25, member 43

255

0.0004259

2.11

227117_at

NA

NA

256

0.0004308

1.57

207124_s_at

GNB5

guanine nucleotide binding protein (G protein), beta 5

257

0.0004325

1.6

227607_at

STAMBPL1

STAM binding protein-like 1

258

0.0004326

1.25

204538_x_at

NPIP

nuclear pore complex interacting protein

259

0.0004339

2.03

244619_at

BCL10

B-cell CLL/lymphoma 10

260

0.0004343

1.38

223239_at

C14orf129

chromosome 14 open reading frame 129

261

0.0004347

1.58

201087_at

PXN

paxillin

262

0.0004367

1.8

219149_x_at

DBR1

debranching enzyme homolog 1 (S. cerevisiae)

263

0.0004371

1.88

229905_at

RAP1GDS1

RAP1, GTP-GDP dissociation stimulator 1

264

0.0004382

1.61

222111_at

NA

NA

265

0.0004389

2.71

235052_at

ZNF792

zinc finger protein 792

266

0.0004422

1.62

225748_at

LTV1

LTV1 homolog (S. cerevisiae)

267

0.0004451

1.37

241741_at

CRLS1

cardiolipin synthase 1

268

0.0004463

1.46

221504_s_at

ATP6V1H

ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H

269

0.0004468

1.98

213448_at

NA

NA

270

0.0004483

1.15

201949_x_at

CAPZB

capping protein (actin filament) muscle Z-line, beta

271

0.0004501

2.15

234295_at

DBR1

debranching enzyme homolog 1 (S. cerevisiae)

272

0.0004505

1.72

217608_at

SFRS12IP1

SFRS12-interacting protein 1

273

0.0004518

1.34

215737_x_at

USF2

upstream transcription factor 2, c-fos interacting

274

0.0004529

1.47

215873_x_at

ABCC10

ATP-binding cassette, sub-family C (CFTR/MRP), member 10

275

0.0004530

2.34

1552256_a_at

SCARB1

scavenger receptor class B, member 1

276

0.0004546

2.47

208657_s_at

9-Sep

septin 9

277

0.0004555

2.08

228096_at

C1orf151

chromosome 1 open reading frame 151

278

0.0004560

1.75

222471_s_at

KCMF1

potassium channel modulatory factor 1

279

0.0004590

1.55

48808_at

DHFR

dihydrofolate reductase

280

0.0004608

3.5

227228_s_at

CCDC88C

coiled-coil domain containing 88C

281

0.0004636

1.94

1558445_at

NA

NA

282

0.0004641

1.13

205540_s_at

RRAGB

Ras-related GTP binding B

283

0.0004670

1.48

227239_at

FAM126A

family with sequence similarity 126, member A

284

0.0004673

1.72

220246_at

CAMK1D

calcium/calmodulin-dependent protein kinase ID

285

0.0004677

3.38

226478_at

NA

NA

286

0.0004700

1.41

230235_at

NA

NA

287

0.0004709

1.22

220750_s_at

LEPRE1

leucine proline-enriched proteoglycan (leprecan) 1

288

0.0004727

2.69

223455_at

TCHP

trichoplein, keratin filament binding

289

0.0004736

1.31

238552_at

NA

NA

290

0.0004739

1.47

200827_at

PLOD1

procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1

291

0.0004751

1.28

227710_s_at

NA

NA

292

0.0004785

4.77

236798_at

NA

NA

293

0.0004788

1.88

242824_at

NA

NA

294

0.0004793

1.08

215846_at

NA

NA

295

0.0004795

1.92

211385_x_at

SULT1A2

sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2

296

0.0004800

1.38

226358_at

LOC145842

hypothetical protein LOC145842

297

0.0004832

1.95

213534_s_at

PASK

PAS domain containing serine/threonine kinase

298

0.0004841

5.65

205698_s_at

MAP2K6

mitogen-activated protein kinase kinase 6

299

0.0004850

1.53

222661_at

AGGF1

angiogenic factor with G patch and FHA domains 1

300

0.0004855

1.43

212036_s_at

PNN

pinin, desmosome associated protein

301

0.0004858

1.6

244534_at

NA

NA

302

0.0004876

1.58

1555751_a_at

GEMIN7

gem (nuclear organelle) associated protein 7

303

0.0004879

1.87

203063_at

PPM1F

protein phosphatase 1F (PP2C domain containing)

304

0.0004973

1.16

205922_at

VNN2

vanin 2

305

0.0004975

1.23

202797_at

SACM1L

SAC1 suppressor of actin mutations 1-like (yeast)

306

0.0005017

2.46

202826_at

SPINT1

serine peptidase inhibitor, Kunitz type 1

307

0.0005059

1.73

226073_at

TMEM218

transmembrane protein 218

308

0.0005077

1.55

238523_at

KLHL36

kelch-like 36 (Drosophila)

309

0.0005080

1.78

231843_at

DDX55

DEAD (Asp-Glu-Ala-Asp) box polypeptide 55

310

0.0005094

2.26

219714_s_at

CACNA2D3

calcium channel, voltage-dependent, alpha 2/delta subunit 3

311

0.0005097

2.02

229202_at

NA

NA

312

0.0005114

3.54

209048_s_at

ZMYND8

zinc finger, MYND-type containing 8

313

0.0005132

1.64

218473_s_at

GLT25D1

glycosyltransferase 25 domain containing 1

314

0.0005172

1.71

65493_at

HEATR6

HEAT repeat containing 6

315

0.0005179

2.03

236194_at

NA

NA

316

0.0005179

2.28

226531_at

ORAI1

ORAI calcium release-activated calcium modulator 1

317

0.0005201

1.58

219351_at

TRAPPC2

trafficking protein particle complex 2

318

0.0005244

1.26

220036_s_at

LMBR1L

limb region 1 homolog (mouse)-like

319

0.0005321

4.22

217974_at

TM7SF3

transmembrane 7 superfamily member 3

320

0.0005335

1.26

211759_x_at

TBCB

tubulin folding cofactor B

321

0.0005359

1.4

242155_x_at

NA

NA

322

0.0005397

2

209377_s_at

HMGN3

high mobility group nucleosomal binding domain 3

323

0.0005401

2.12

230653_at

LOC100132218

hypothetical protein LOC100132218

324

0.0005504

1.77

224708_at

KIAA2013

KIAA2013

325

0.0005504

1.9

204000_at

GNB5

guanine nucleotide binding protein (G protein), beta 5

326

0.0005559

1.32

244346_at

NA

NA

327

0.0005568

1.9

225108_at

AGPS

alkylglycerone phosphate synthase

328

0.0005599

1.85

236626_at

NA

NA

329

0.0005615

1.85

228314_at

LRRC8C

leucine rich repeat containing 8 family, member C

330

0.0005636

1.46

1558754_at

ZNF763

zinc finger protein 763

331

0.0005650

1.42

226155_at

FAM160B1

family with sequence similarity 160, member B1

332

0.0005679

1.72

229705_at

NA

NA

333

0.0005686

4.21

228891_at

C9orf164

chromosome 9 open reading frame 164

334

0.0005708

1.49

225146_at

C9orf25

chromosome 9 open reading frame 25

335

0.0005724

1.86

219817_at

C12orf47

chromosome 12 open reading frame 47

336

0.0005724

1.58

235610_at

ALKBH8

alkB, alkylation repair homolog 8 (E. coli)

337

0.0005728

1.59

217949_s_at

VKORC1

vitamin K epoxide reductase complex, subunit 1

338

0.0005746

2.14

222858_s_at

DAPP1

dual adaptor of phosphotyrosine and 3-phosphoinositides

339

0.0005748

1.17

223049_at

GRB2

growth factor receptor-bound protein 2

340

0.0005792

1.45

212987_at

FBXO9

F-box protein 9

341

0.0005793

1.42

209903_s_at

ATR

ataxia telangiectasia and Rad3 related

342

0.0005805

1.45

201067_at

PSMC2

proteasome (prosome, macropain) 26S subunit, ATPase, 2

343

0.0005806

1.37

201076_at

NHP2L1

NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)

344

0.0005811

1.28

236804_at

NA

NA

345

0.0005820

1.27

234107_s_at

DTD1

D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)

346

0.0005858

2.04

1553987_at

C12orf47

chromosome 12 open reading frame 47

347

0.0005877

1.42

226679_at

SLC26A11

solute carrier family 26, member 11

348

0.0005893

1.7

1554608_at

TGOLN2

trans-golgi network protein 2

349

0.0005911

1.65

219256_s_at

SH3TC1

SH3 domain and tetratricopeptide repeats 1

350

0.0005950

1.46

232369_at

NA

NA

351

0.0005992

1.39

243750_x_at

C21orf70

chromosome 21 open reading frame 70

352

0.0006007

2.4

219759_at

ERAP2

endoplasmic reticulum aminopeptidase 2

353

0.0006025

1.24

203981_s_at

ABCD4

ATP-binding cassette, sub-family D (ALD), member 4

354

0.0006028

1.43

202428_x_at

DBI

diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)

355

0.0006039

1.54

212886_at

CCDC69

coiled-coil domain containing 69

356

0.0006041

2.12

221878_at

C2orf68

chromosome 2 open reading frame 68

357

0.0006052

1.91

202039_at

TIAF1

TGFB1-induced anti-apoptotic factor 1

358

0.0006058

2.8

40472_at

LPCAT4

lysophosphatidylcholine acyltransferase 4

359

0.0006135

1.48

217751_at

GSTK1

glutathione S-transferase kappa 1

360

0.0006135

1.84

228303_at

GALNT6

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)

361

0.0006147

1.44

202172_at

VEZF1

vascular endothelial zinc finger 1

362

0.0006167

2.09

1558692_at

C1orf85

chromosome 1 open reading frame 85

363

0.0006190

1.89

207122_x_at

SULT1A2

sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2

364

0.0006205

1.49

1560874_at

FLJ33046

hypothetical gene supported by AK057608

365

0.0006228

1.97

212473_s_at

MICAL2

microtubule associated monoxygenase, calponin and LIM domain containing 2

366

0.0006241

1.67

225409_at

C2orf64

chromosome 2 open reading frame 64

367

0.0006246

1.97

203615_x_at

SULT1A1

sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1

368

0.0006275

1.4

224724_at

SULF2

sulfatase 2

369

0.0006277

1.47

225022_at

GOPC

golgi associated PDZ and coiled-coil motif containing

370

0.0006282

1.18

214879_x_at

USF2

upstream transcription factor 2, c-fos interacting

371

0.0006311

1.43

222843_at

FIGNL1

fidgetin-like 1

372

0.0006313

2.06

210136_at

MBP

myelin basic protein

373

0.0006322

2.27

229512_at

FAM120C

family with sequence similarity 120C

374

0.0006326

1.2

209017_s_at

LONP1

lon peptidase 1, mitochondrial

375

0.0006333

1.69

237926_s_at

NA

NA

376

0.0006351

1.44

222294_s_at

RAB27A

RAB27A, member RAS oncogene family

377

0.0006411

3.49

210986_s_at

TPM1

tropomyosin 1 (alpha)

378

0.0006490

1.28

209932_s_at

DUT

deoxyuridine triphosphatase

379

0.0006513

1.28

227656_at

C6orf70

chromosome 6 open reading frame 70

380

0.0006514

1.63

228131_at

ERCC1

excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)

381

0.0006519

1.11

212848_s_at

C9orf3

chromosome 9 open reading frame 3

382

0.0006526

2.3

1552540_s_at

IQCD

IQ motif containing D

383

0.0006530

2.09

239698_at

NA

NA

384

0.0006586

1.62

1553102_a_at

CCDC69

coiled-coil domain containing 69

385

0.0006622

1.77

228542_at

MRS2

MRS2 magnesium homeostasis factor homolog (S. cerevisiae)

386

0.0006623

1.37

208956_x_at

DUT

deoxyuridine triphosphatase

387

0.0006635

2.14

223528_s_at

METT11D1

methyltransferase 11 domain containing 1

388

0.0006636

1.38

201234_at

ILK

integrin-linked kinase

389

0.0006637

1.57

228694_at

NA

NA

390

0.0006659

1.36

225136_at

PLEKHA2

pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2

391

0.0006723

1.55

212567_s_at

MAP4

microtubule-associated protein 4

392

0.0006726

1.52

219549_s_at

RTN3

reticulon 3

393

0.0006730

1.89

232681_at

NA

NA

394

0.0006742

2.21

219627_at

ZNF767

zinc finger family member 767

395

0.0006762

2.7

231449_at

NA

NA

396

0.0006771

1.58

239035_at

MTHFR

5,10-methylenetetrahydrofolate reductase (NADPH)

397

0.0006773

1.39

205256_at

ZBTB39

zinc finger and BTB domain containing 39

398

0.0006786

1.51

205945_at

IL6R

interleukin 6 receptor

399

0.0006802

4.26

230032_at

OSGEPL1

O-sialoglycoprotein endopeptidase-like 1

400

0.0006837

1.56

225888_at

C12orf30

chromosome 12 open reading frame 30

401

0.0006840

1.35

227767_at

CSNK1G3

casein kinase 1, gamma 3

402

0.0006879

1.76

205060_at

PARG

poly (ADP-ribose) glycohydrolase

403

0.0006921

1.37

239730_at

DGCR14

DiGeorge syndrome critical region gene 14

404

0.0006924

1.58

201029_s_at

CD99

CD99 molecule

405

0.0006928

1.63

211709_s_at

CLEC11A

C-type lectin domain family 11, member A

406

0.0006952

1.95

201985_at

KIAA0196

KIAA0196

407

0.0006964

2.17

204995_at

CDK5R1

cyclin-dependent kinase 5, regulatory subunit 1 (p35)

408

0.0007029

1.52

217521_at

NA

NA

409

0.0007045

1.35

1558184_s_at

ZNF17

zinc finger protein 17

410

0.0007099

1.24

218167_at

AMZ2

archaelysin family metallopeptidase 2

411

0.0007119

1.52

226712_at

SSR1

signal sequence receptor, alpha

412

0.0007129

1.22

238668_at

NA

NA

413

0.0007138

1.16

221651_x_at

IGKC

immunoglobulin kappa constant

414

0.0007143

1.85

64064_at

GIMAP5

GTPase, IMAP family member 5

415

0.0007160

1.24

234734_s_at

TNRC6A

trinucleotide repeat containing 6A

416

0.0007165

1.34

213582_at

ATP11A

ATPase, class VI, type 11A

417

0.0007176

1.34

226165_at

C8orf59

chromosome 8 open reading frame 59

418

0.0007186

2.61

205565_s_at

FXN

frataxin

419

0.0007225

1.21

220251_at

C1orf107

chromosome 1 open reading frame 107

420

0.0007231

2.16

225980_at

C14orf43

chromosome 14 open reading frame 43

421

0.0007247

1.69

238379_x_at

NA

NA

422

0.0007266

1.72

1559034_at

SIRPB2

signal-regulatory protein beta 2

423

0.0007273

1.21

201053_s_at

PSMF1

proteasome (prosome, macropain) inhibitor subunit 1 (PI31)

424

0.0007318

1.1

40225_at

GAK

cyclin G associated kinase

425

0.0007329

2.14

209729_at

GAS2L1

growth arrest-specific 2 like 1

426

0.0007344

1.55

221027_s_at

PLA2G12A

phospholipase A2, group XIIA

427

0.0007348

1.28

209724_s_at

ZFP161

zinc finger protein 161 homolog (mouse)

428

0.0007380

1.4

214494_s_at

SPG7

spastic paraplegia 7 (pure and complicated autosomal recessive)

429

0.0007392

1.58

205131_x_at

CLEC11A

C-type lectin domain family 11, member A

430

0.0007393

2.07

204019_s_at

SH3YL1

SH3 domain containing, Ysc84-like 1 (S. cerevisiae)

431

0.0007417

1.42

214861_at

JMJD2C

jumonji domain containing 2C

432

0.0007421

1.69

242965_at

NA

NA

433

0.0007485

1.99

228167_at

KLHL6

kelch-like 6 (Drosophila)

434

0.0007547

2.15

209269_s_at

SYK

spleen tyrosine kinase

435

0.0007563

1.5

244663_at

NA

NA

436

0.0007563

2.14

203802_x_at

NSUN5

NOL1/NOP2/Sun domain family, member 5

437

0.0007578

1.62

242108_at

NA

NA

438

0.0007655

1.46

205632_s_at

PIP5K1B

phosphatidylinositol-4-phosphate 5-kinase, type I, beta

439

0.0007691

2.28

238604_at

NA

NA

440

0.0007694

1.25

219084_at

NSD1

nuclear receptor binding SET domain protein 1

441

0.0007712

1.4

223716_s_at

ZRANB2

zinc finger, RAN-binding domain containing 2

442

0.0007728

1.82

209760_at

KIAA0922

KIAA0922

443

0.0007796

1.29

214437_s_at

SHMT2

serine hydroxymethyltransferase 2 (mitochondrial)

444

0.0007836

1.46

224704_at

TNRC6A

trinucleotide repeat containing 6A

445

0.0007841

2.01

223339_at

ATPIF1

ATPase inhibitory factor 1

446

0.0007848

1.59

222622_at

PGP

phosphoglycolate phosphatase

447

0.0007851

1.62

218231_at

NAGK

N-acetylglucosamine kinase

448

0.0007878

1.79

1554544_a_at

MBP

myelin basic protein

449

0.0007894

2.2

1554250_s_at

TRIM73

tripartite motif-containing 73

450

0.0007896

2.19

216199_s_at

MAP3K4

mitogen-activated protein kinase kinase kinase 4

451

0.0007925

1.3

206881_s_at

LILRA3

leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3

452

0.0007976

1.65

226716_at

PRR12

proline rich 12

453

0.0007989

1.67

202534_x_at

DHFR

dihydrofolate reductase

454

0.0007995

2.43

202369_s_at

TRAM2

translocation associated membrane protein 2

455

0.0008009

2.59

218112_at

MRPS34

mitochondrial ribosomal protein S34

456

0.0008035

1.48

230925_at

APBB1IP

amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein

457

0.0008086

1.16

213027_at

TROVE2

TROVE domain family, member 2

458

0.0008124

2.99

1562289_at

NA

NA

459

0.0008148

1.41

202615_at

GNAQ

guanine nucleotide binding protein (G protein), q polypeptide

460

0.0008150

1.71

219151_s_at

RABL2B

RAB, member of RAS oncogene family-like 2B

461

0.0008158

2.1

1559214_at

NA

NA

462

0.0008161

1.84

203711_s_at

HIBCH

3-hydroxyisobutyryl-Coenzyme A hydrolase

463

0.0008187

1.87

233955_x_at

CXXC5

CXXC finger 5

464

0.0008205

1.26

201804_x_at

TBCB

tubulin folding cofactor B

465

0.0008207

1.44

211100_x_at

LILRA2

leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2

466

0.0008229

5.13

212757_s_at

CAMK2G

calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma

467

0.0008232

1.76

214202_at

NA

NA

468

0.0008255

2.01

221746_at

UBL4A

ubiquitin-like 4A

469

0.0008277

1.35

1560587_s_at

PRDX5

peroxiredoxin 5

470

0.0008278

1.41

211070_x_at

DBI

diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)

471

0.0008279

1.53

242887_at

KCMF1

potassium channel modulatory factor 1

472

0.0008283

1.29

206200_s_at

ANXA11

annexin A11

473

0.0008318

1.72

203607_at

INPP5F

inositol polyphosphate-5-phosphatase F

474

0.0008344

1.9

205282_at

LRP8

low density lipoprotein receptor-related protein 8, apolipoprotein e receptor

475

0.0008347

1.42

209566_at

INSIG2

insulin induced gene 2

476

0.0008361

1.54

223306_at

EBPL

emopamil binding protein-like

477

0.0008444

3.9

210166_at

TLR5

toll-like receptor 5

478

0.0008451

1.44

225050_at

ZNF512

zinc finger protein 512

479

0.0008463

1.9

226480_at

NA

NA

480

0.0008510

1.22

211152_s_at

HTRA2

HtrA serine peptidase 2

481

0.0008526

1.9

222603_at

ERMP1

endoplasmic reticulum metallopeptidase 1

482

0.0008590

1.42

226078_at

RPUSD1

RNA pseudouridylate synthase domain containing 1

483

0.0008602

1.89

203409_at

DDB2

damage-specific DNA binding protein 2, 48kDa

484

0.0008607

1.79

222996_s_at

CXXC5

CXXC finger 5

485

0.0008619

1.42

229597_s_at

WDFY4

WDFY family member 4

486

0.0008625

1.21

209420_s_at

SMPD1

sphingomyelin phosphodiesterase 1, acid lysosomal

487

0.0008648

2.16

213333_at

MDH2

malate dehydrogenase 2, NAD (mitochondrial)

488

0.0008654

1.57

232524_x_at

ANAPC4

anaphase promoting complex subunit 4

489

0.0008674

1.63

238058_at

FLJ27365

FLJ27365 protein

490

0.0008682

2.88

212660_at

PHF15

PHD finger protein 15

491

0.0008701

2.47

209197_at

SYT11

synaptotagmin XI

492

0.0008755

1.49

200875_s_at

NOL5A

nucleolar protein 5A (56kDa with KKE/D repeat)

493

0.0008868

5.04

207008_at

IL8RB

interleukin 8 receptor, beta

494

0.0008925

1.33

233694_at

HSPA1L

heat shock 70kDa protein 1-like

495

0.0008958

1.35

217957_at

C16orf80

chromosome 16 open reading frame 80

496

0.0008961

1.64

228070_at

PPP2R5E

protein phosphatase 2, regulatory subunit B@#$%&, epsilon isoform

497

0.0008967

1.56

225997_at

MOBKL1A

MOB1, Mps One Binder kinase activator-like 1A (yeast)

498

0.0009020

1.98

65438_at

KIAA1609

KIAA1609

499

0.0009056

1.82

218921_at

SIGIRR

single immunoglobulin and toll-interleukin 1 receptor (TIR) domain

500

0.0009103

1.06

240001_at

NA

NA

501

0.0009114

1.51

227533_at

NA

NA

502

0.0009136

1.47

226333_at

IL6R

interleukin 6 receptor

503

0.0009154

1.68

1562249_at

LOC285965

hypothetical protein LOC285965

504

0.0009189

3.86

204301_at

KBTBD11

kelch repeat and BTB (POZ) domain containing 11

505

0.0009197

1.67

213296_at

RER1

RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)

506

0.0009228

1.32

224688_at

C7orf42

chromosome 7 open reading frame 42

507

0.0009245

1.91

221843_s_at

KIAA1609

KIAA1609

508

0.0009272

1.24

1569808_at

NA

NA

509

0.0009308

5.94

38290_at

RGS14

regulator of G-protein signaling 14

510

0.0009357

3.85

226820_at

ZNF362

zinc finger protein 362

511

0.0009370

1.35

241344_at

NA

NA

512

0.0009378

1.73

228512_at

PTCD3

Pentatricopeptide repeat domain 3

513

0.0009417

1.63

210830_s_at

PON2

paraoxonase 2

514

0.0009436

1.44

219493_at

SHCBP1

SHC SH2-domain binding protein 1

515

0.0009471

1.38

230122_at

MLLT10

myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10

516

0.0009526

1.67

218380_at

NLRP1

NLR family, pyrin domain containing 1

517

0.0009562

1.42

202200_s_at

SRPK1

SFRS protein kinase 1

518

0.0009575

1.63

202741_at

PRKACB

protein kinase, cAMP-dependent, catalytic, beta

519

0.0009592

1.43

228869_at

NA

NA

520

0.0009614

1.25

224252_s_at

FXYD5

FXYD domain containing ion transport regulator 5

521

0.0009626

1.45

221488_s_at

CUTA

cutA divalent cation tolerance homolog (E. coli)

522

0.0009634

1.7

244687_at

DBT

dihydrolipoamide branched chain transacylase E2

523

0.0009679

1.17

209445_x_at

C7orf44

chromosome 7 open reading frame 44

524

0.0009703

1.14

244537_at

NA

NA

525

0.0009717

1.7

226104_at

RNF170

ring finger protein 170

526

0.0009730

1.31

205240_at

GPSM2

G-protein signaling modulator 2 (AGS3-like, C. elegans)

527

0.0009732

1.73

200766_at

CTSD

cathepsin D

528

0.0009734

1.41

231844_at

MGC27345

hypothetical protein MGC27345

529

0.0009738

1.29

202634_at

POLR2K

polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa

530

0.0009760

1.58

224938_at

NUFIP2

nuclear fragile X mental retardation protein interacting protein 2

531

0.0009764

2.26

204089_x_at

MAP3K4

mitogen-activated protein kinase kinase kinase 4

532

0.0009776

1.93

211985_s_at

CALM1

calmodulin 1 (phosphorylase kinase, delta)

533

0.0009778

2.65

213280_at

GARNL4

GTPase activating Rap/RanGAP domain-like 4

534

0.0009805

1.48

236016_at

NA

NA

535

0.0009828

1.84

217394_at

NA

NA

536

0.0009900

1.58

201030_x_at

LDHB

lactate dehydrogenase B

537

0.0009925

1.81

227379_at

MBOAT1

membrane bound O-acyltransferase domain containing 1

538

0.0009997

-1.19

236663_at

NA

NA

539

0.0009983

-1.6

219766_at

B9D2

B9 protein domain 2

540

0.0009949

-1.71

204157_s_at

KIAA0999

KIAA0999 protein

541

0.0009891

-1.23

214060_at

SSBP1

single-stranded DNA binding protein 1

542

0.0009868

-1.47

226276_at

TMEM167A

transmembrane protein 167A

543

0.0009825

-1.75

203596_s_at

IFIT5

interferon-induced protein with tetratricopeptide repeats 5

544

0.0009805

-1.64

226310_at

RICTOR

rapamycin-insensitive companion of mTOR

545

0.0009772

-2.29

218986_s_at

DDX60

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

546

0.0009758

-1.52

217618_x_at

HUS1

HUS1 checkpoint homolog (S. pombe)

547

0.0009746

-2.4

219017_at

ETNK1

ethanolamine kinase 1

548

0.0009745

-1.24

201957_at

PPP1R12B

protein phosphatase 1, regulatory (inhibitor) subunit 12B

549

0.0009737

-1.26

240887_at

NA

NA

550

0.0009681

-1.33

209514_s_at

RAB27A

RAB27A, member RAS oncogene family

551

0.0009661

-2.54

219026_s_at

RASAL2

RAS protein activator like 2

552

0.0009592

-1.49

211395_x_at

FCGR2C

Fc fragment of IgG, low affinity IIc, receptor for (CD32)

553

0.0009568

-3.72

205126_at

VRK2

vaccinia related kinase 2

554

0.0009560

-1.22

1556514_at

LOC338809

hypothetical protein LOC338809

555

0.0009506

-2.66

206991_s_at

CCR5

chemokine (C-C motif) receptor 5

556

0.0009500

-1.47

212840_at

UBXN7

UBX domain protein 7

557

0.0009443

-1.25

244496_at

NA

NA

558

0.0009406

-1.21

236108_at

KIAA1632

KIAA1632

559

0.0009366

-1.2

203654_s_at

COIL

coilin

560

0.0009338

-2.95

236156_at

LIPA

lipase A, lysosomal acid, cholesterol esterase

561

0.0009309

-1.3

212462_at

MYST4

MYST histone acetyltransferase (monocytic leukemia) 4

562

0.0009278

-2.58

219403_s_at

HPSE

heparanase

563

0.0009220

-1.58

1554747_a_at

2-Sep

septin 2

564

0.0009134

-1.08

203291_at

CNOT4

CCR4-NOT transcription complex, subunit 4

565

0.0009077

-1.25

243772_at

SDCCAG8

serologically defined colon cancer antigen 8

566

0.0009071

-1.7

201656_at

ITGA6

integrin, alpha 6

567

0.0009063

-3.06

201325_s_at

EMP1

epithelial membrane protein 1

568

0.0009031

-1.27

209531_at

GSTZ1

glutathione transferase zeta 1

569

0.0008974

-1.42

208779_x_at

DDR1

discoidin domain receptor tyrosine kinase 1

570

0.0008959

-1.19

242654_at

FANCC

Fanconi anemia, complementation group C

571

0.0008945

-1.16

220386_s_at

EML4

echinoderm microtubule associated protein like 4

572

0.0008922

-1.32

227003_at

RAB28

RAB28, member RAS oncogene family

573

0.0008910

-3.14

224009_x_at

DHRS9

dehydrogenase/reductase (SDR family) member 9

574

0.0008877

-1.67

32069_at

N4BP1

NEDD4 binding protein 1

575

0.0008870

-1.29

232141_at

U2AF1

U2 small nuclear RNA auxiliary factor 1

576

0.0008761

-1.35

240468_at

NA

NA

577

0.0008698

-1.32

204367_at

SP2

Sp2 transcription factor

578

0.0008616

-1.87

225076_s_at

ZNFX1

zinc finger, NFX1-type containing 1

579

0.0008599

-1.25

225056_at

SIPA1L2

signal-induced proliferation-associated 1 like 2

580

0.0008580

-1.13

207070_at

RGR

retinal G protein coupled receptor

581

0.0008574

-1.28

217129_at

NA

NA

582

0.0008537

-1.22

225268_at

KPNA4

karyopherin alpha 4 (importin alpha 3)

583

0.0008463

-1.07

232295_at

GFM1

G elongation factor, mitochondrial 1

584

0.0008408

-1.33

211975_at

ARFGAP2

ADP-ribosylation factor GTPase activating protein 2

585

0.0008385

-1.24

244625_at

NA

NA

586

0.0008384

-1.49

202083_s_at

SEC14L1

SEC14-like 1 (S. cerevisiae)

587

0.0008274

-1.34

232987_at

ARL17

ADP-ribosylation factor-like 17

588

0.0008198

-1.33

1570541_s_at

NA

NA

589

0.0008196

-2.91

201324_at

EMP1

epithelial membrane protein 1

590

0.0008172

-1.42

222408_s_at

YPEL5

yippee-like 5 (Drosophila)

591

0.0008164

-1.3

201585_s_at

SFPQ

splicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated)

592

0.0008160

-1.35

243492_at

THEM4

thioesterase superfamily member 4

593

0.0008023

-1.53

222537_s_at

CDC42SE1

CDC42 small effector 1

594

0.0007993

-1.38

223225_s_at

SEH1L

SEH1-like (S. cerevisiae)

595

0.0007951

-1.4

231139_at

NA

NA

596

0.0007921

-3.08

206911_at

TRIM25

tripartite motif-containing 25

597

0.0007824

-1.55

1554390_s_at

ACTR2

ARP2 actin-related protein 2 homolog (yeast)

598

0.0007777

-1.32

208824_x_at

PCTK1

PCTAIRE protein kinase 1

599

0.0007732

-1.36

214258_x_at

KAT5

K(lysine) acetyltransferase 5

600

0.0007729

-1.47

208751_at

NAPA

N-ethylmaleimide-sensitive factor attachment protein, alpha

601

0.0007690

-1.16

238337_s_at

DNAJC21

DnaJ (Hsp40) homolog, subfamily C, member 21

602

0.0007673

-1.31

211314_at

CACNA1G

calcium channel, voltage-dependent, T type, alpha 1G subunit

603

0.0007657

-1.53

217834_s_at

SYNCRIP

synaptotagmin binding, cytoplasmic RNA interacting protein

604

0.0007625

-1.85

208653_s_at

CD164

CD164 molecule, sialomucin

605

0.0007608

-1.45

209091_s_at

SH3GLB1

SH3-domain GRB2-like endophilin B1

606

0.0007426

-1.25

1557533_at

NA

NA

607

0.0007405

-2.01

1555785_a_at

XRN1

5@#$%&-3@#$%& exoribonuclease 1

608

0.0007371

-1.41

236961_at

NA

NA

609

0.0007346

-1.14

204080_at

TOE1

target of EGR1, member 1 (nuclear)

610

0.0007341

-1.29

243852_at

LUC7L2

LUC7-like 2 (S. cerevisiae)

611

0.0007227

-1.29

210317_s_at

YWHAE

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide

612

0.0007183

-1.4

209284_s_at

C3orf63

chromosome 3 open reading frame 63

613

0.0007169

-3.19

227361_at

HS3ST3B1

heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1

614

0.0007139

-1.19

211066_x_at

PCDHGC3

protocadherin gamma subfamily C, 3

615

0.0006984

-1.09

202814_s_at

HEXIM1

hexamethylene bis-acetamide inducible 1

616

0.0006943

-1.35

226710_at

C8orf82

chromosome 8 open reading frame 82

617

0.0006932

-3.2

209969_s_at

STAT1

signal transducer and activator of transcription 1, 91kDa

618

0.0006882

-1.56

225242_s_at

CCDC80

coiled-coil domain containing 80

619

0.0006875

-1.5

214121_x_at

PDLIM7

PDZ and LIM domain 7 (enigma)

620

0.0006868

-1.41

203916_at

NDST2

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2

621

0.0006826

-1.32

208901_s_at

TOP1

topoisomerase (DNA) I

622

0.0006769

-2.95

206028_s_at

MERTK

c-mer proto-oncogene tyrosine kinase

623

0.0006749

-1.35

205724_at

PKP1

plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)

624

0.0006737

-1.23

228121_at

NA

NA

625

0.0006701

-1.04

226928_x_at

SLC25A37

solute carrier family 25, member 37

626

0.0006700

-1.37

1555301_a_at

DIP2A

DIP2 disco-interacting protein 2 homolog A (Drosophila)

627

0.0006616

-1.27

1566301_at

PPP1R11

protein phosphatase 1, regulatory (inhibitor) subunit 11

628

0.0006570

-1.46

234519_at

NOBOX

NOBOX oogenesis homeobox

629

0.0006553

-1.24

218520_at

TBK1

TANK-binding kinase 1

630

0.0006552

-1.55

201878_at

ARIH1

ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)

631

0.0006495

-1.3

1564131_a_at

NA

NA

632

0.0006472

-1.49

209102_s_at

HBP1

HMG-box transcription factor 1

633

0.0006450

-1.18

238586_at

LOC731489

hypothetical protein LOC731489

634

0.0006425

-1.03

216231_s_at

B2M

beta-2-microglobulin

635

0.0006398

-1.79

1552772_at

CLEC4D

C-type lectin domain family 4, member D

636

0.0006384

-1.42

201586_s_at

SFPQ

splicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated)

637

0.0006373

-1.74

41644_at

SASH1

SAM and SH3 domain containing 1

638

0.0006346

-1.11

216652_s_at

DR1

down-regulator of transcription 1, TBP-binding (negative cofactor 2)

639

0.0006313

-1.3

212436_at

TRIM33

tripartite motif-containing 33

640

0.0006284

-1.57

212264_s_at

WAPAL

wings apart-like homolog (Drosophila)

641

0.0006259

-1.2

226481_at

VPRBP

Vpr (HIV-1) binding protein

642

0.0006104

-1.35

217490_at

NA

NA

643

0.0006091

-1.29

1557463_at

NA

NA

644

0.0005929

-1.35

238273_at

PL-5283

PL-5283 protein

645

0.0005927

-1.77

203840_at

BLZF1

basic leucine zipper nuclear factor 1

646

0.0005896

-1.17

237604_at

LOC415056

hypothetical gene LOC415056

647

0.0005883

-1.9

222881_at

HPSE

heparanase

648

0.0005855

-1.25

220634_at

TBX4

T-box 4

649

0.0005853

-1.3

200669_s_at

UBE2D3

ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)

650

0.0005801

-1.05

232017_at

TJP2

tight junction protein 2 (zona occludens 2)

651

0.0005772

-1.35

213918_s_at

NIPBL

Nipped-B homolog (Drosophila)

652

0.0005770

-1.62

215357_s_at

POLDIP3

polymerase (DNA-directed), delta interacting protein 3

653

0.0005750

-1.4

1561354_at

NA

NA

654

0.0005678

-1.08

206516_at

AMH

anti-Mullerian hormone

655

0.0005652

-2.05

211030_s_at

SLC6A6

solute carrier family 6 (neurotransmitter transporter, taurine), member 6

656

0.0005634

-2.18

222651_s_at

TRPS1

trichorhinophalangeal syndrome I

657

0.0005618

-2.05

57703_at

SENP5

SUMO1/sentrin specific peptidase 5

658

0.0005604

-11.89

211372_s_at

IL1R2

interleukin 1 receptor, type II

659

0.0005547

-1.2

1567246_at

OR5H1

olfactory receptor, family 5, subfamily H, member 1

660

0.0005488

-1.85

205003_at

DOCK4

dedicator of cytokinesis 4

661

0.0005371

-2.37

222262_s_at

ETNK1

ethanolamine kinase 1

662

0.0005358

-1.38

201684_s_at

TOX4

TOX high mobility group box family member 4

663

0.0005357

-1.85

206011_at

CASP1

caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)

664

0.0005349

-1.16

211505_s_at

STAU1

staufen, RNA binding protein, homolog 1 (Drosophila)

665

0.0005342

-1.47

1554049_s_at

WDR42A

WD repeat domain 42A

666

0.0005321

-1.36

225978_at

FAM80B

family with sequence similarity 80, member B

667

0.0005228

-1.15

215056_at

NA

NA

668

0.0005162

-1.38

202066_at

PPFIA1

protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1

669

0.0005087

-1.13

226128_at

NA

NA

670

0.0005005

-1.17

1562449_s_at

NA

NA

671

0.0004997

-1.51

217847_s_at

THRAP3

thyroid hormone receptor associated protein 3

672

0.0004992

-1.6

229845_at

MAPKAP1

mitogen-activated protein kinase associated protein 1

673

0.0004955

-2.82

211806_s_at

KCNJ15

potassium inwardly-rectifying channel, subfamily J, member 15

674

0.0004947

-2.32

217503_at

NA

NA

675

0.0004946

-1.2

221147_x_at

WWOX

WW domain containing oxidoreductase

676

0.0004897

-1.26

1552684_a_at

SENP8

SUMO/sentrin specific peptidase family member 8

677

0.0004707

-1.17

206251_s_at

AVPR1A

arginine vasopressin receptor 1A

678

0.0004609

-1.24

223546_x_at

LUC7L

LUC7-like (S. cerevisiae)

679

0.0004595

-1.33

208576_s_at

HIST1H3B

histone cluster 1, H3b

680

0.0004582

-1.97

202684_s_at

RNMT

RNA (guanine-7-) methyltransferase

681

0.0004567

-1.36

201378_s_at

UBAP2L

ubiquitin associated protein 2-like

682

0.0004553

-1.15

202178_at

PRKCZ

protein kinase C, zeta

683

0.0004545

-1.13

1555139_a_at

OTUD7B

OTU domain containing 7B

684

0.0004543

-1.47

244595_at

NA

NA

685

0.0004511

-1.32

210592_s_at

04/01/12

spermidine/spermine N1-acetyltransferase 1

686

0.0004444

-1.21

1554327_a_at

CANT1

calcium activated nucleotidase 1

687

0.0004435

-1.41

223430_at

SNF1LK2

SNF1-like kinase 2

688

0.0004430

-1.42

232437_at

CPSF3L

cleavage and polyadenylation specific factor 3-like

689

0.0004418

-1.11

202230_s_at

CHERP

calcium homeostasis endoplasmic reticulum protein

690

0.0004358

-1.8

211782_at

IDS

iduronate 2-sulfatase

691

0.0004288

-1.63

208869_s_at

GABARAPL1

GABA(A) receptor-associated protein like 1

692

0.0004258

-1.14

1554646_at

OSBPL1A

oxysterol binding protein-like 1A

693

0.0004189

-1.29

224410_s_at

LMBR1

limb region 1 homolog (mouse)

694

0.0004130

-1.09

201698_s_at

SFRS9

splicing factor, arginine/serine-rich 9

695

0.0004109

-1.57

218578_at

CDC73

cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)

696

0.0003904

-1.3

1566456_at

NA

NA

697

0.0003884

-2.78

226026_at

DIRC2

disrupted in renal carcinoma 2

698

0.0003884

-1.49

222035_s_at

PAPOLA

poly(A) polymerase alpha

699

0.0003882

-1.25

240313_at

DMRTB1

DMRT-like family B with proline-rich C-terminal, 1

700

0.0003880

-1.65

242943_at

ST8SIA4

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4

701

0.0003868

-2.87

243271_at

NA

NA

702

0.0003850

-1.43

234173_s_at

NXF2

nuclear RNA export factor 2

703

0.0003839

-1.93

211368_s_at

CASP1

caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)

704

0.0003823

-1.24

227712_at

LYRM2

LYR motif containing 2

705

0.0003803

-1.63

201377_at

UBAP2L

ubiquitin associated protein 2-like

706

0.0003785

-1.4

204858_s_at

TYMP

thymidine phosphorylase

707

0.0003695

-1.53

205415_s_at

ATXN3

ataxin 3

708

0.0003684

-2.46

209237_s_at

SLC23A2

solute carrier family 23 (nucleobase transporters), member 2

709

0.0003661

-1.25

235833_at

PPAT

phosphoribosyl pyrophosphate amidotransferase

710

0.0003575

-1.29

209590_at

BMP7

bone morphogenetic protein 7

711

0.0003529

-3.5

215966_x_at

GK3P

glycerol kinase 3 pseudogene

712

0.0003527

-1.22

202807_s_at

TOM1

target of myb1 (chicken)

713

0.0003455

-1.18

201198_s_at

PSMD1

proteasome (prosome, macropain) 26S subunit, non-ATPase, 1

714

0.0003409

-3.97

202068_s_at

LDLR

low density lipoprotein receptor

715

0.0003389

-1.07

200914_x_at

KTN1

kinectin 1 (kinesin receptor)

716

0.0003355

-1.77

225395_s_at

FAM120AOS

family with sequence similarity 120A opposite strand

717

0.0003300

-1.17

216306_x_at

PTBP1

polypyrimidine tract binding protein 1

718

0.0003300

-1.38

208985_s_at

EIF3J

eukaryotic translation initiation factor 3, subunit J

719

0.0003231

-1.15

1569932_at

NHSL2

NHS-like 2

720

0.0003229

-1.41

204781_s_at

FAS

Fas (TNF receptor superfamily, member 6)

721

0.0003210

-2

209593_s_at

TOR1B

torsin family 1, member B (torsin B)

722

0.0003206

-1.3

237285_at

SORBS2

sorbin and SH3 domain containing 2

723

0.0003169

-1.19

202550_s_at

VAPB

VAMP (vesicle-associated membrane protein)-associated protein B and C

724

0.0003084

-1.34

201461_s_at

MAPKAPK2

mitogen-activated protein kinase-activated protein kinase 2

725

0.0003068

-1.11

1563069_at

NA

NA

726

0.0002955

-1.14

218382_s_at

U2AF2

U2 small nuclear RNA auxiliary factor 2

727

0.0002940

-1.11

205570_at

PIP4K2A

phosphatidylinositol-5-phosphate 4-kinase, type II, alpha

728

0.0002921

-1.28

208642_s_at

XRCC5

X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)

729

0.0002910

-1.24

221603_at

PEX16

peroxisomal biogenesis factor 16

730

0.0002863

-1.21

231211_s_at

LOC541469

hypothetical protein LOC541469

731

0.0002857

-2.02

219062_s_at

ZCCHC2

zinc finger, CCHC domain containing 2

732

0.0002808

-1.2

218570_at

KBTBD4

kelch repeat and BTB (POZ) domain containing 4

733

0.0002799

-1.16

223545_at

FANCD2

Fanconi anemia, complementation group D2

734

0.0002764

-1.34

1555614_at

SUGT1P

suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae)

735

0.0002736

-1.53

1556283_s_at

FGFR1OP2

FGFR1 oncogene partner 2

736

0.0002703

-1.66

226022_at

SASH1

SAM and SH3 domain containing 1

737

0.0002699

-1.87

214838_at

SFT2D2

SFT2 domain containing 2

738

0.0002674

-1.26

206307_s_at

FOXD1

forkhead box D1

739

0.0002668

-1.41

208108_s_at

AVPR2

arginine vasopressin receptor 2

740

0.0002633

-1.21

239949_at

THNSL2

threonine synthase-like 2 (S. cerevisiae)

741

0.0002619

-1.76

1554096_a_at

RBM33

RNA binding motif protein 33

742

0.0002577

-1.25

203039_s_at

NDUFS1

NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)

743

0.0002569

-3.7

1563541_at

NA

NA

744

0.0002547

-1.33

210569_s_at

SIGLEC9

sialic acid binding Ig-like lectin 9

745

0.0002484

-1.44

203922_s_at

CYBB

cytochrome b-245, beta polypeptide

746

0.0002482

-1.33

220012_at

ERO1LB

ERO1-like beta (S. cerevisiae)

747

0.0002373

-2.41

236106_at

NA

NA

748

0.0002362

-1.34

242834_at

NA

NA

749

0.0002316

-1.2

220498_at

ACTL7B

actin-like 7B

750

0.0002303

-1.44

240873_x_at

DAB2

disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)

751

0.0002296

-1.19

221471_at

SERINC3

serine incorporator 3

752

0.0002267

-1.74

213236_at

SASH1

SAM and SH3 domain containing 1

753

0.0002262

-1.62

213988_s_at

04/01/12

spermidine/spermine N1-acetyltransferase 1

754

0.0002220

-1.2

239372_at

NA

NA

755

0.0002208

-1.35

240079_at

ZNF81

zinc finger protein 81

756

0.0002182

-1.65

205227_at

IL1RAP

interleukin 1 receptor accessory protein

757

0.0002149

-1.5

223751_x_at

TLR10

toll-like receptor 10

758

0.0002132

-1.35

1553677_a_at

TIPRL

TIP41, TOR signaling pathway regulator-like (S. cerevisiae)

759

0.0002103

-1.44

AFFX-HUMISGF3A/M97935_5_at

STAT1

signal transducer and activator of transcription 1, 91kDa

760

0.0002103

-1.11

202240_at

PLK1

polo-like kinase 1 (Drosophila)

761

0.0002099

-1.28

1556281_at

NA

NA

762

0.0002093

-1.53

222989_s_at

UBQLN1

ubiquilin 1

763

0.0002070

-1.16

204682_at

LTBP2

latent transforming growth factor beta binding protein 2

764

0.0002018

-1.37

225830_at

PDZD8

PDZ domain containing 8

765

0.0002016

-1.34

229208_at

CEP27

centrosomal protein 27kDa

766

0.0002006

-1.38

202211_at

ARFGAP3

ADP-ribosylation factor GTPase activating protein 3

767

0.0001969

-1.21

208696_at

CCT5

chaperonin containing TCP1, subunit 5 (epsilon)

768

0.0001905

-1.71

219207_at

EDC3

enhancer of mRNA decapping 3 homolog (S. cerevisiae)

769

0.0001804

-1.31

221248_s_at

WHSC1L1

Wolf-Hirschhorn syndrome candidate 1-like 1

770

0.0001758

-1.59

211781_x_at

NA

NA

771

0.0001730

-1.36

226037_s_at

TAF9B

TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa

772

0.0001724

-1.14

200901_s_at

M6PR

mannose-6-phosphate receptor (cation dependent)

773

0.0001713

-1.67

213173_at

PCNX

pecanex homolog (Drosophila)

774

0.0001667

-2.06

206038_s_at

NR2C2

nuclear receptor subfamily 2, group C, member 2

775

0.0001616

-1.24

225397_at

C15orf57

chromosome 15 open reading frame 57

776

0.0001297

-2.14

211367_s_at

CASP1

caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)

777

0.0001209

-1.66

222810_s_at

RASAL2

RAS protein activator like 2

778

0.0001196

-1.23

231718_at

SLU7

SLU7 splicing factor homolog (S. cerevisiae)

779

0.0001187

-1.32

223905_at

CCDC135

coiled-coil domain containing 135

780

0.0001127

-1.28

211672_s_at

ARPC4

actin related protein 2/3 complex, subunit 4, 20kDa

781

0.0001127

-1.38

200828_s_at

ZNF207

zinc finger protein 207

782

0.0001073

-1.29

244211_at

NA

NA

783

0.0001070

-12.04

205403_at

IL1R2

interleukin 1 receptor, type II

784

0.0001065

-1.83

209970_x_at

CASP1

caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)

785

0.0001034

-6.35

217502_at

IFIT2

interferon-induced protein with tetratricopeptide repeats 2

786

0.0001029

-2.07

237867_s_at

PID1

phosphotyrosine interaction domain containing 1

787

0.0001028

-1.26

218516_s_at

IMPAD1

inositol monophosphatase domain containing 1

788

9.94E-005

-1.64

226312_at

RICTOR

rapamycin-insensitive companion of mTOR

789

9.41E-005

-1.2

210940_s_at

GRM1

glutamate receptor, metabotropic 1

790

9.02E-005

-1.36

1554556_a_at

ATP11B

ATPase, class VI, type 11B

791

8.89E-005

-1.14

226735_at

TAPT1

transmembrane anterior posterior transformation 1

792

8.70E-005

-3.84

213006_at

CEBPD

CCAAT/enhancer binding protein (C/EBP), delta

793

8.35E-005

-1.31

207787_at

KRT33B

keratin 33B

794

8.34E-005

-1.29

207410_s_at

TLX2

T-cell leukemia homeobox 2

795

8.21E-005

-1.6

223596_at

SLC12A6

solute carrier family 12 (potassium/chloride transporters), member 6

796

7.98E-005

-1.23

231859_at

C14orf132

chromosome 14 open reading frame 132

797

7.81E-005

-1.25

228277_at

FBXL19

F-box and leucine-rich repeat protein 19

798

7.75E-005

-1.35

210470_x_at

NONO

non-POU domain containing, octamer-binding

799

7.52E-005

-1.29

222432_s_at

CCDC47

coiled-coil domain containing 47

800

7.19E-005

-1.8

238496_at

NA

NA

801

7.11E-005

-1.38

208698_s_at

NONO

non-POU domain containing, octamer-binding

802

7.08E-005

-4.66

203946_s_at

ARG2

arginase, type II

803

7.03E-005

-1.17

1559952_x_at

LOC100132923

similar to hCG1993470

804

6.19E-005

-2.35

220104_at

ZC3HAV1

zinc finger CCCH-type, antiviral 1

805

5.57E-005

-2.43

203595_s_at

IFIT5

interferon-induced protein with tetratricopeptide repeats 5

806

5.53E-005

-1.33

1569859_at

NA

NA

807

5.31E-005

-1.5

224359_s_at

HOOK3

hook homolog 3 (Drosophila)

808

4.19E-005

-2.51

205921_s_at

SLC6A6

solute carrier family 6 (neurotransmitter transporter, taurine), member 6

809

3.18E-005

-2.18

205749_at

CYP1A1

cytochrome P450, family 1, subfamily A, polypeptide 1

810

2.93E-005

-1.38

1566136_at

NA

NA

811

2.02E-005

-1.51

210992_x_at

FCGR2C

Fc fragment of IgG, low affinity IIc, receptor for (CD32)

812

1.61E-005

-1.22

207801_s_at

RNF10

ring finger protein 10

813

1.32E-005

-2.03

222816_s_at

ZCCHC2

zinc finger, CCHC domain containing 2

814

1.29E-005

-1.25

211884_s_at

CIITA

class II, major histocompatibility complex, transactivator

815

8.60E-006

-1.68

212664_at

TUBB4

tubulin, beta 4

816

4.60E-006

-1.16

212081_x_at

BAT2

HLA-B associated transcript 2

817

3.60E-006

-1.21

1554177_a_at

ATP5S

ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)

818

7.00E-007

-1.82

224783_at

FAM100B

family with sequence similarity 100, member B

819

6.00E-007

-1.57

208840_s_at

G3BP2

GTPase activating protein (SH3 domain) binding protein 2

820

4.00E-007

-1.59

206717_at

MYH8

myosin, heavy chain 8, skeletal muscle, perinatal

https://static-content.springer.com/image/art%3A10.1186%2F1471-2172-13-33/MediaObjects/12865_2011_Article_459_Fig3_HTML.jpg
Figure 3

Supervised microarray analysis. A.) Hierarchical cluster analysis showing the 820 probe sets which were differentially expressed at the 0.001 significance level. The arrays clustering on the left are from control samples, whereas the cluster on the right shows the LT treated samples. Up-regulated genes are shown in red and down-regulated genes are shown in blue. B.) Biocarta pathway analysis showing the pathways most significantly affected by LT, along with the number of genes and p-value within each pathway that were affected. C.) Correlation of genes altered after treatment with anthrax LT using microarray analysis versus RT-PCR. Spearman correlation coefficient = 0.885.

Using the Gene Set Expression Comparison Analysis, as implemented in BRB Array tools, the Biocarta pathways that were associated with the differentially regulated genes were identified. Over 60 differentially regulated pathways were discovered in monocytes in response to LT treatment. As expected, the most significant pathway affected by LT treatment was the MAPK signaling pathway, with the p38 MAPK signaling pathway being most impacted with 103 genes affected (Figure 3B). Additional pathways altered by LT at the p < 0.001 significance level included the IL-18, Toll-Like Receptor, IFN alpha, and G-Protein Family signaling pathways. It is interesting to note that a previous study measuring the transcriptional response of human alveolar macrophages to anthrax spores detected an activation of the TLR pathways[22], and our results indicated anthrax LT targets 87 genes within the TLR signaling pathway (Figure 3B).

RGS14 is a protein involved in the regulation of G-protein signaling through attenuation of G-protein heterotrimer signaling, thereby inactivating this signaling cascade. The Affymetrix microarrays revealed that RGS14 expression in LT treated monocytes showed a 6 fold increase in expression (Table 2). This is a potentially significant finding in that RGS14 inhibits G-proteins important for chemotaxis. Therefore LT could be impairing chemotaxis not only by blocking Hsp27 phosphorylation through disruption of the p38 pathway[23], but also by causing over-expression of RGS14, thereby inhibiting G-protein mediated signaling required for actin-based motility.
Table 2

Predicted effects of LT on monocyte function.1

Gene

Microarray

Effects

RGS-14

5.61

Blockade of monocyte maturation to dendritic cells, inhibition of chemotaxis

CXCR2

5.04

Increased monocyte transendothelial migration into tissues

HPSE

-2.58

Diminished inflammatory response

CCR5

-2.33

Reduced responsiveness to the inflammatory mediators RANTES, MIP1 beta

ILIR2

-12.5

Increased IL1 alpha responsiveness and increased fever

1 Calculated fold changes compared to mock treated samples.

RGS14 expression is down-regulated during the maturation of monocytes to dendritic cells[24] and over-expression of this G-protein regulator would be expected to block monocyte maturation. RGS14 levels are also known to decrease in dendritic cells exposed to Leishmania major or Toxoplasma gondii, suggesting that RGS14 downregulation may be an important step in a normal immune response, and up-regulation of RGS14 by LT could be contributing to LT’s immunosuppressive effects[25].

Three chemokine receptors were also altered after LT treatment, suggesting that LT may be inducing functional defects in monocyte response signaling. IL-8 receptor beta (CXCR2) was up-regulated after LT treatment (Table 2). CXCR2 transduces signaling through a G-protein activated second messenger system. This receptor is important for monocyte transendothelial migration, and up-regulation of CXCR2 could serve to enhance the delivery of monocytes to tissues. Anthrax spores must be phagocytosed by macrophages in order to germinate into viable bacteria. An increase in the macrophage pool may aid in a reservoir for increased germination of viable bacteria. IL-1 receptor type II (IL-1R2), was found to be markedly down-regulated. IL-1R2 is a decoy receptor for IL-1 that functions either at the cell surface or in a soluble form[26]. The decreased expression of the decoy receptor would presumably increase IL-1a levels and increase the febrile response of the host potentially at least in part explaining the high fever that commonly accompanies systemic anthrax[27]. CCR5 is a receptor for the monocyte chemokines RANTES and MIP. The down-regulation of CCR5 by LT could reflect an inability of toxin-treated monocytes to differentiate into macrophages[28] (Table 2). During the early stages of infection, macrophages play a critical role in assisting B. anthracis pathogenesis by providing a place for bacteria germination from their spore form to viable bacteria. An increase in monocyte trafficking to allow an increase in spore uptake and subsequent germination would prove beneficial for B. anthracis. During later stages of infection, after release of viable bacteria, limiting monocyte differentiation to macrophages would assist in preventing clearance of viable bacteria.

In addition to an alteration in the chemokine response by LT, an additional enzyme, heparanase (HPSE), was found to be decreased in LT-treated human monocytes. This enzyme is an endoglycosidase that degrades heparin sulfate, resulting in disassembly of extracellular barriers required for cell migration[29]. Heparanase has also been postulated to play a role in inflammation[30] and our results showed a 2.6 fold decrease in heparanase gene expression (Table 2). One study has concluded that an in vivo siRNA against heparanase, along with an inhibitor of its enzymatic activity, results in a diminished inflammatory response[31]. Thus LT- mediated inhibition of heparanase expression could also contribute to the inhibition of the host immune response during an anthrax infection.

An external verification method using quantitative real-time PCR was utilized to confirm the microarray data. The eight genes corresponding to RGS14, IL8RB, TLR5, PPM1H, CD47, SYK, CCR5, and IL1R2 were chosen for microarray confirmation in monocytes. CCR5 and IL1R2 were confirmed to be down-regulated at 4 h after LT treatment, reinforcing the microarray data, while the other six genes were up-regulated, again confirming the microarray data (Table 3). A correlation curve was plotted (Figure 3C) and analyzed, showing a linear relationship between the microarray results and RT-PCR with a correlation coefficient of 0.885. Results were performed in duplicates and fold values were normalized to GAPDH. To exclude the possibility the lymphocyte contamination might be contributing to our microarray findings, a higher purity monocyte population (98% purity), obtained by adherence followed by washing off non-adherent lymphocytes, was treated with 500 ng/mL LT for 4 h and gene expression was assessed using real-time PCR. These experiments verified 3 genes to be increased after LT treatment: RGS14, TLR5, and CD47 (1.21-1.70), as observed by the microarray of suspended cells. These findings suggest that the changes in messenger RNA observed are primarily contributed by monocytes, but we cannot entirely exclude a contribution by lymphocytes.
Table 3

q-RTPCR confirmation of LT-induced genes.1

Probe

Microarray

q-RT-PCR

Gene name

Primer sequence

38290_at

5.61

7.40

RGS14-F

CAGGGATCTGTGAGAAACGAG

   

RGS14-R

AGGTGATCCTGTTTTCCAGC

207008_at

5.04

7.50

IL8RB-F

GTCTAACAGCTCTGACTACCAC

   

L8RB-R

TTAAATCCTGACTGGGTCGC

210166_at

3.90

2.24

TLR5-F

TTTTCAGGAGCCCGAGC

   

TLR5-R

AGCCGAGATTGTGTCACTG

212686_at

2.65

3.85

PPM1H-F

GAGTACAGAGAAAGGAGCTTGG

   

PPM1H-R

TCCAATAGTTGCCATTACCCG

226016_at

2.38

1.60

CD47-F

TTTGCTATACTCCTGTTCTGGG

   

CD47-R

TGGGACGAAAAGAATGGCTC

209269_at

2.15

1.60

SYK-F

CAAGTTCTCCAGCAAAAGCG

   

SYK-R

CATCCGCTCTCCTTTCTCTAAC

206991_at

-2.66

-2.33

CCR5-F

CCAAAAGCACATTGCCAAACG

   

CCR5-R

ACTTGAGTCCGTGTCACAAGCC

205403_at

-12.5

-28.0

IL1R2-F

TGGCACCTACGTCTGCACTACT

   

IL1R2-R

TTGCGGGTATGAGATGAACG

1 Calculated fold changes comparedtomock treated samples.

Conclusions

Our investigations show human peripheral monocytes are susceptible to the actions of anthrax LT and do not undergo LT-mediated cytotoxicity after a four hour toxin treatment. We also find that LT induces changes in several genes involved in previously unidentified pathways including the TLR pathway, IFN alpha pathway, and G-Protein family signaling pathways. The identification of several previously unappreciated gene products including RGS14, IL8 receptor beta, CD47, TNF ligand, IL-16, Syk, CCR5, and IL-1 receptor II adds to our understanding of how LT impacts the immune response. Our pathway analysis reveals that anthrax LT targets multiple normal immune-regulatory pathways that would be expected to protect the host against anthrax infection. The increase in RGS14 levels and decrease in CCR5, along with IL-1R2, would likely impair monocyte functions and help to facilitate bacteria survival. B. anthracis maintains a selective advantage by impairing the host immune responses, thereby allowing for invasion and dissemination of the highly fatal bacilli. Our findings encourage further investigations into how these pathways converge functionally to impair normal monocyte function, along with providing new insights into the regulation of the host defense system and inflammation.

Methods

Monocyte isolation and toxin treatment

Whole blood was collected by venous puncture from healthy human volunteers into 8 mL vacutainer tubes containing Ficoll (BD Biosciences). The study followed US Department of Health and Human Services guidelines and was approved by the University of Florida Institutional Review Board. Whole blood was incubated with a monocyte negative selection antibody (Stem Cell Technologies) for 20 min., centrifuged 1700 × g for 25 min at RT, no brake over Ficoll, re-suspended in 10 mL RPMI (Mediatech) complete media, centrifuged at 250 × g for 9 min. to remove platelets, and re-suspended to 7-9 × 105 cells/mL in RPMI. Monocytes were inverted at 37°C with 500 ng/mL LF and 500 ng/mL PA for 4 h. Additional qRT-PCR experiments were performed using higher monocyte purities (98%), obtained by first using a negative selection antibody cocktail (Stem Cell Technologies) isolation technique, followed by plastic adherence for 4 h, as described previously[32].

Toxin purification

LF and PA were purified as previously described[33]. Briefly, Bacillus anthracis culture media was filtered through a 0.22 uM filter, followed by diethylaminoethyl cellulose (DEAE) anion exchange chromatography. The toxins were then subjected to gel filtration and hydrophobic interaction fast protein liquid chromatography (FPLC) and highly purified toxin components were confirmed by Coomassie Blue staining.

Monocyte purity and apoptosis analysis

Monocytes were inverted at 37°C with 500 ng/mL LF and 500 ng/mL PA for 4 h, stained with CD-14 Pac Blue (BD Biosciences), Annexin-V-Fluorescein and propidium iodide (Roche). The cell population was gated first for CD14-Pac-Blue followed by analysis of the relative amount of Annexin (FL1) and PI (FL2) using flow cytometry FACScan (BD), and analyzed by FCS Express (De Novo).

MEK cleavage

Purified monocytes were incubated at 37°C with 500 ng/mL lethal toxin for 4 h. Cells were lysed, ran on a 10% SDS-PAGE gel (Pierce), transferred to a PVDF membrane (Bio-rad) and probed for MEK1 (Upstate). Membranes were then stripped and probed for MEK3 (Santa Cruz). β-actin (Sigma) was used to check consistent loading amounts.

RNA isolation

Purified monocytes from 4 healthy volunteers were incubated at 37°C with media alone or with 500 ng/mL LT for 4 h. Total RNA was collected using RNAeasy mini kit (Qiagen) and RNA quantity and quality was assessed using NanoDrop (Thermo Scientific) technology.

Microarray procedure

100 ng total RNA was labeled using Affymetrix GeneChip® 3' IVT Express Kit for each replicate. Amplified labeled RNA was purified, fragmented, then hybridized for 16 h on Affymetrix GeneChips® (HG U133 plus 2.0) representing approximately 22,000 well-characterized human genes. Arrays were washed using Affymetrix GeneChip® Fluidics Station FS450 and scanned using GeneChip® Scanner 3000 7 G.

Microarray analysis

Low-level analysis was performed using dChipmodeled-based expression matrix (dChip 2007 (DNA-Chip Analyzer), Build date: Jan 4, 2008). Unsupervised analysis - probes sets whose hybridization signal intensity exhibited a coefficient of variation of greater than 0.5 were analyzed by unsupervised hierarchical cluster analysis using algorithms implemented in dChip. Supervised analysis - significant probe sets between the treatment groups were identified using a paired t-test (by donor) at a significance threshold of p < 0.001. Leave-one-out-cross-validation using 4 prediction models was used to test the ability of probe sets significant at p < 0.001 to distinguish between the treatment groups. Microarray analyses were done using dCHIP and BRB-ArrayTools by Richard Simon (http://linus.nci.nih.gov/BRB-ArrayTools.html). The microarray data for this study was deposited in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO)[30] with accession numbersGSM848717 through GSM 848724. The microarray data is also available in a series with accession number GSE34407.

Quantitative real time-PCR (qRT-PCR)

RNA was collected using RNAeasy mini kit (Qiagen), quantitated using a Nanodrop system (Thermo Scientific), and 233 μg total RNA was used for cDNAsynthesis using SuperScript III First-Strand Synthesis (Invitrogen). cDNA was quantitated using SYBR Green JumpStart TaqReadyMix (Sigma) and 10 mM forward and 10 mM reverse primers were used for each indicated reaction. Primers used were as follows ACTB-F TCACCGAGCGCGGCT,ACTB-R TAATGTCACGCACGATTTCCC,GAPDH-F GGTGAAGGTCGGAGTCAACG, and GAPDH-R AGAGTTAAAAGCAGCCCTGGTG. All other primers are listed in Table 2. Reactions were run on the MJR Opticon Continuous Fluorescence detector (Bio-Rad) and analyzed with Opticon Monitor Software 1.08 (Bio-Rad).

Declarations

Acknowledgements

We thank Dr. Lyle Moldawer for his guidance and assistance in the flow cytometry analysis. The study was supported by the National Institutes of Health RO1AI064891. Publication of this article was funded in part by the University of Florida Open-Access Publishing Fund.

Authors’ Affiliations

(1)
Department of Medicine, University of Florida College of Medicine
(2)
USA, Department of Molecular Genetics and Microbiology, University of Florida
(3)
Centers for Disease Control and Prevention

References

  1. Fukao T: Immune system paralysis by anthrax lethal toxin: the roles of innate and adaptive immunity. Lancet Infect Dis. 2004, 4: 166-170. 10.1016/S1473-3099(04)00940-5.PubMedView ArticleGoogle Scholar
  2. Mock M, Fouet A: Anthrax. Annu Rev Microbiol. 2001, 55: 647-671. 10.1146/annurev.micro.55.1.647.PubMedView ArticleGoogle Scholar
  3. Collier RJ, Young JA: Anthrax toxin. Annu Rev Cell Dev Biol. 2003, 19: 45-70. 10.1146/annurev.cellbio.19.111301.140655.PubMedView ArticleGoogle Scholar
  4. Pellizzari R, Guidi-Rontani C, Vitale G, Mock M, Montecucco C: Lethal factor of Bacillus anthracis cleaves the N-terminus of MAPKKs: analysis of the intracellular consequences in macrophages. Int J Med Microbiol. 2000, 290: 421-427. 10.1016/S1438-4221(00)80056-9.PubMedView ArticleGoogle Scholar
  5. Duesbery NS, Webb CP, Leppla SH, Gordon VM, Klimpel KR, Copeland TD, Ahn NG, Oskarsson MK, Fukasawa K, Paull KD: Proteolytic inactivation of MAP-kinase-kinase by anthrax lethal factor. Science. 1998, 280: 734-737. 10.1126/science.280.5364.734.PubMedView ArticleGoogle Scholar
  6. Leppla SH: Anthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclic AMP concentrations of eukaryotic cells. Proc Natl Acad Sci U S A. 1982, 79: 3162-3166. 10.1073/pnas.79.10.3162.PubMedPubMed CentralView ArticleGoogle Scholar
  7. Hanna PC, Acosta D, Collier RJ: On the role of macrophages in anthrax. Proc Natl Acad Sci U S A. 1993, 90: 10198-10201. 10.1073/pnas.90.21.10198.PubMedPubMed CentralView ArticleGoogle Scholar
  8. Hanna PC, Kruskal BA, Ezekowitz RA, Bloom BR, Collier RJ: Role of macrophage oxidative burst in the action of anthrax lethal toxin. Mol Med. 1994, 1: 7-18.PubMedPubMed CentralGoogle Scholar
  9. Popov SG, Villasmil R, Bernardi J, Grene E, Cardwell J, Popova T, Wu A, Alibek D, Bailey C, Alibek K: Effect of Bacillus anthracis lethal toxin on human peripheral blood mononuclear cells. FEBS Lett. 2002, 527: 211-215. 10.1016/S0014-5793(02)03228-3.PubMedView ArticleGoogle Scholar
  10. Kassam A, Der SD, Mogridge J: Differentiation of human monocytic cell lines confers susceptibility to Bacillus anthracis lethal toxin. Cell Microbiol. 2005, 7: 281-292.PubMedView ArticleGoogle Scholar
  11. Stearns-Kurosawa DJ, Lupu F, Taylor FB, Kinasewitz G, Kurosawa S: Sepsis and pathophysiology of anthrax in a nonhuman primate model. Am J Pathol. 2006, 169: 433-444. 10.2353/ajpath.2006.051330.PubMedPubMed CentralView ArticleGoogle Scholar
  12. Guarner J, Jernigan JA, Shieh WJ, Tatti K, Flannagan LM, Stephens DS, Popovic T, Ashford DA, Perkins BA, Zaki SR: Pathology and pathogenesis of bioterrorism-related inhalational anthrax. Am J Pathol. 2003, 163: 701-709. 10.1016/S0002-9440(10)63697-8.PubMedPubMed CentralView ArticleGoogle Scholar
  13. Twenhafel NA, Leffel E, Pitt ML: Pathology of inhalational anthrax infection in the african green monkey. Vet Pathol. 2007, 44: 716-721. 10.1354/vp.44-5-716.PubMedView ArticleGoogle Scholar
  14. Wu W, Mehta H, Chakrabarty K, Booth JL, Duggan ES, Patel KB, Ballard JD, Coggeshall KM, Metcalf JP: Resistance of human alveolar macrophages to Bacillus anthracis lethal toxin. J Immunol. 2009, 183: 5799-5806. 10.4049/jimmunol.0803406.PubMedPubMed CentralView ArticleGoogle Scholar
  15. Comer JE, Galindo CL, Chopra AK, Peterson JW: GeneChip analyses of global transcriptional responses of murine macrophages to the lethal toxin of Bacillus anthracis. Infect Immun. 2005, 73: 1879-1885. 10.1128/IAI.73.3.1879-1885.2005.PubMedPubMed CentralView ArticleGoogle Scholar
  16. Mesters RM, Florke N, Ostermann H, Kienast J: Increase of plasminogen activator inhibitor levels predicts outcome of leukocytopenic patients with sepsis. Thromb Haemost. 1996, 75: 902-907.PubMedGoogle Scholar
  17. Bradburne C, Chung MC, Zong Q, Schlauch K, Liu D, Popova T, Popova A, Bailey C, Soppet D, Popov S: Transcriptional and apoptotic responses of THP-1 cells to challenge with toxigenic, and non-toxigenic Bacillus anthracis. BMC Immunol. 2008, 9: 67-10.1186/1471-2172-9-67.PubMedPubMed CentralView ArticleGoogle Scholar
  18. Serbina NV, Jia T, Hohl TM, Pamer EG: Monocyte-mediated defense against microbial pathogens. Annu Rev Immunol. 2008, 26: 421-452. 10.1146/annurev.immunol.26.021607.090326.PubMedPubMed CentralView ArticleGoogle Scholar
  19. Mosser DM: The many faces of macrophage activation. J Leukoc Biol. 2003, 73: 209-212. 10.1189/jlb.0602325.PubMedView ArticleGoogle Scholar
  20. Koski GK, Lyakh LA, Rice NR: Rapid lipopolysaccharide-induced differentiation of CD14(+) monocytes into CD83(+) dendritic cells is modulated under serum-free conditions by exogenously added IFN-gamma and endogenously produced IL-10. Eur J Immunol. 2001, 31: 3773-3781. 10.1002/1521-4141(200112)31:12<3773::AID-IMMU3773>3.0.CO;2-W.PubMedView ArticleGoogle Scholar
  21. van Furth R: Origin and turnover of monocytes and macrophages. Curr Top Pathol. 1989, 79: 125-150. 10.1007/978-3-642-73855-5_6.PubMedView ArticleGoogle Scholar
  22. Dozmorov M, Wu W, Chakrabarty K, Booth JL, Hurst RE, Coggeshall KM, Metcalf JP: Gene expression profiling of human alveolar macrophages infected by B. anthracis spores demonstrates TNF-alpha and NF-kappab are key components of the innate immune response to the pathogen. BMC Infect Dis. 2009, 9: 152-10.1186/1471-2334-9-152.PubMedPubMed CentralView ArticleGoogle Scholar
  23. During RL, Gibson BG, Li W, Bishai EA, Sidhu GS, Landry J, Southwick FS: Anthrax lethal toxin paralyzes actin-based motility by blocking Hsp27 phosphorylation. EMBO J. 2007, 26: 2240-2250. 10.1038/sj.emboj.7601687.PubMedPubMed CentralView ArticleGoogle Scholar
  24. Shi GX, Harrison K, Han SB, Moratz C, Kehrl JH: Toll-like receptor signaling alters the expression of regulator of G protein signaling proteins in dendritic cells: implications for G protein- coupled receptor signaling. J Immunol. 2004, 172: 5175-5184.PubMedView ArticleGoogle Scholar
  25. Chaussabel D, Semnani RT, McDowell MA, Sacks D, Sher A, Nutman TB: Unique gene expression profiles of human macrophages and dendritic cells to phylogenetically distinct parasites. Blood. 2003, 102: 672-681. 10.1182/blood-2002-10-3232.PubMedView ArticleGoogle Scholar
  26. Colotta F, Re F, Muzio M, Bertini R, Polentarutti N, Sironi M, Giri JG, Dower SK, Sims JE, Mantovani A: Interleukin-1 type II receptor: a decoy target for IL-1 that is regulated by IL-4. Science. 1993, 261: 472-475. 10.1126/science.8332913.PubMedView ArticleGoogle Scholar
  27. Jernigan DB, Raghunathan PL, Bell BP, Brechner R, Bresnitz EA, Butler JC, Cetron M, Cohen M, Doyle T, Fischer M: Investigation of bioterrorism-related anthrax, United States, 2001: epidemiologic findings. Emerg Infect Dis. 2002, 8: 1019-1028. 10.3201/eid0810.020353.PubMedPubMed CentralView ArticleGoogle Scholar
  28. Tuttle DL, Harrison JK, Anders C, Sleasman JW, Goodenow MM: Expression of CCR5 increases during monocyte differentiation and directly mediates macrophage susceptibility to infection by human immunodeficiency virus type 1. J Virol. 1998, 72: 4962-4969.PubMedPubMed CentralGoogle Scholar
  29. Vlodavsky I, Eldor A, Haimovitz-Friedman A, Matzner Y, Ishai-Michaeli R, Lider O, Naparstek Y, Cohen IR, Fuks Z: Expression of heparanase by platelets and circulating cells of the immune system: possible involvement in diapedesis and extravasation. Invasion Metastasis. 1992, 12: 112-127.PubMedGoogle Scholar
  30. Vaday GG, Lider O: Extracellular matrix moieties, cytokines, and enzymes: dynamic effects on immune cell behavior and inflammation. J Leukoc Biol. 2000, 67: 149-159.PubMedGoogle Scholar
  31. Edovitsky E, Lerner I, Zcharia E, Peretz T, Vlodavsky I, Elkin M: Role of endothelial heparanase in delayed-type hypersensitivity. Blood. 2006, 107: 3609-3616. 10.1182/blood-2005-08-3301.PubMedPubMed CentralView ArticleGoogle Scholar
  32. Elkord E, Williams PE, Kynaston H, Rowbottom AW: Human monocyte isolation methods influence cytokine production from in vitro generated dendritic cells. Immunology. 2005, 114: 204-212. 10.1111/j.1365-2567.2004.02076.x.PubMedPubMed CentralView ArticleGoogle Scholar
  33. Quinn CP, Shone CC, Turnbull PC, Melling J: Purification of anthrax-toxin components by high- performance anion-exchange, gel-filtration and hydrophobic-interaction chromatography. Biochem J. 1988, 252: 753-758.PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Chauncey et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.