Skip to main content

Table 3 Oligonucleotide primers and PCR conditions for the characterization of subolesin and pathogen-specific gene expression.

From: Subolesin expression in response to pathogen infection in ticks

Gene descriptiona Upstream/downstream primer sequences (5'-3') PCR annealing conditions
D. variabilis subolesin [9] CCAGCCTCTGTTCACCTTTC
CCGCTTCTGAATTTGGTCAT
54°C,
30 sec
R. microplus subolesin [9] CACAGTCCGAGTGGCAGAT
GATGCACTGGTGACGAGAGA
55°C,
30 sec
A. marginale msp4[29] GGGAGCTCCTATGAATTACAGAGAATTGTTTAC
CCGGATCCTTAGCTGAACAGGAATCTTGC
60°C,
1 min
A. phagocytophilum msp4[9] GACGTGCTGCACACAGATTT
CTCATCAAATAGCCCGTGGT
54°C,
1 min
E. canis 16S (M73221) GTGGCAGACGGGTGAGTAAT
GCTGATCGTCCTCTCAGACC
57°C,
30 sec
B. subtilis dal[35] AATTGAAAGGGACCGACATC-
TTAATGGTTTCGAGCCTTCC
59°C,
30 sec
E. coli dxs[36] CGAGAAACTGGCGATCCTTA
CTTCATCAAGCGGTTTCACA
60°C,
30 sec
P. pastoris CTA 1 (AB472085) CCTGAAGGACGCCAATATGT
GCTTTCCAGCCTCTTCATTG
57°C,
30 sec
Tick 16S rRNA [9] GACAAGAAGACCCTA
ATCCAACATCGAGGT
42°C,
30 sec
  1. aWhen published, references are shown for oligonucleotide sequences. When designed for this study, GenBank accession numbers are shown in parenthesis.