Skip to main content

Table 1 Primers used for real-time PCR analysis

From: The absence of MyD88 has no effect on the induction of alternatively activated macrophage during Fasciola hepatica infection

Gene Forward Reverse Annealing
Temp (°C)
Arginase1 GGTCCAGAAGAATGGAAGAGTCAG CAGATATGCAGGGAGTCACC 54
RELMα GGTCCCAGTGCATATGGATGAGACCATAGA CACCTCTTCACTCGAGGGACAGTTGGCAGC 54
Ym1 TCACAGGTCTGGCAATTCTTCTG TTTGTCCTTAGGAGGGCTTCCTCG. 62
β-Actin GAATCCTGTGGCATCCATGAAAC TAAAACGCAGCTCAGTAACAGTCCG 54