Skip to main content

Table 1 Primer sequences used for cytokine and cytokine receptor real-time PCR assays

From: Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green

Gene name 5'-3' primer sequence Position cDNA-genea Accession Numberb
IL1a FW AAGACAAGCCTGTGTTGCTGAAGG 663–747 D00403
  RW TCCCAGAAGAAAATGAGGTCGGTC Int. span. NW_047658
IL1b FW CACCTCTCAAGCAGAGCACAG 793–871 M98820
  RW GGGTTCCATGGTGAAGTCAAC Exon NW_047658
IL1RA FW AAGACCTTCTACCTGAGGAACAACC 139–255 M63101
  RW GCCCAAGAACACATTCCGAAAGTC Int. span. NW_047651
IL1R1 FW GTTTTTGGAACACCCTTCAGCC 1209–1313 M95578
  RW ACGAAGCAGATGAACGGATAGC Exon NW_047814.1
IL1R2 FW CATTCAGACACCTCCAGCAGTTC 328–443 Z22812
  RW ACCCAGAGCGTATCATCCTTCAC Exon NW_047814.1
IL6 FW TCCTACCCCAACTTCCAATGCTC 532–610 E02522
  RW TTGGATGGTCTTGGTCCTTAGCC Exon M26745
IL6R FW AAGCAGGTCCAGCCACAATGTAG 696–812 NM_017020
  RW CCAACTGACTTTGAGCCAACGAG Int. span. NW_047626.1
TNFa FW AAATGGGCTCCCTCTCATCAGTTC 195–305 X66539
  RW TCTGCTTGGTGGTTTGCTACGAC Int. span. D00475
TNF-r2 FW TGCAACAAGACTTCAGACACCGTG 142–224 AF420214
  RW AGGCATGTATGCAGATGGTTCCAG Exon NW_047727.1
  1. Note. FW forward primer; RW reverse primer; IL, interleukin; IL-r, interleukin receptor; TNFα, Tumor necrosis factor α; TNF-r2, Tumor necrosis factor receptor 2. a Position of amplification product within cDNA sequence (upper line) and within genomic sequences (lower line). Exon; both primers bound on the same exon, Int. span.: primers bound on different exons, , b Genbank accession number of cDNA (upper line) and genomic sequences or contigs (lower line), available at http://www.ncbi.nlm.nih.gov/