Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 2 Newborn IgM VH regions predominantly use only the DH1 gene. The aligned IgM cDNA clones from Figure 2 were analyzed for DH gene usage by comparison to the horn shark genomic DH genes (Accession #X13447 [33]). The DH gene portion that exactly matches the horn shark is underlined and italicized nucleotides indicate non-templated GC nucleotide additions. Clones that could not be conclusively identified as either DH gene are indicated by (?). CDR3 identical in sequence to both DH genes are indicated by (D1/D2). Clones 22E and 36E excluded due their non-productive rearrangement.

From: Diversity and repertoire of IgW and IgM VH families in the newborn nurse shark

  Horn shark X13447 DH1 GGTACAGCAGTGGGT DH2 ATATCTGGGTG D1 GTAVG D2 ISGW
I 54S GTGGGTAC TGGT   VGTG  
  30E AGCCACGGGGAGAGGAGCCAGAGCCACTGTGGCTATCTT (D1/D2)   SHGERSQSHCGYL  
II 1E CAACTACA GGACTGGG ATGATCCA   QLQDWDDP  
  72S GACGACAGTGGG GGGTCTCCC ATACTGGGT CCGACCTACTAT DDSGGSP ILGPTYY
  35S   GACGGAGTGATA CTGGG A   DGVILG
  14E GACTACAGTG CCTGGG ATACCATTGGT DYS AWDTIG
III 17S   ACAACAAACTCTCTGGGT   TTNSLG
  6E   ACAATA TTCGGT   TIFG
  57S ACTACTTTCGGT (?)   TTFG  
IV 55E   AGGGGGGGGGA CTGGG GTAGGTTCGCT   RGGDWGRFA
  26E AAGACCCACC TACAG TCTATA CTGGG GTCCTTCGCT KTHLQSI LGSFA
  15S GCCTC AGTGG AGCGGGAATTCGCT   ASVEREFA  
  24S GATGGTG GGGT AGGGGAATTCGCT (D1/D2)   DGGVGEFA  
  46S AGCAGTGGGT ACGAATTCGCT   SSGYEFA  
  29S GTCAGGGGGGAGGCGGTT (?)   VRGEAV  
  73S GACACAGT AGGGGGAGCG   DTVGGA  
V 2S ACAGAAAGTGGG GGGGG TGGG GCCGGT TESG GGGAG
  49S ACAGATATCAGTGG CCGGGTAGCCGGT   TDISGRVAG  
  M92851 ACAAGACGCATG AGTGGG TATGAATACT TGGG CGGCCACTCCGGT TRRMSGYEY LGGHSG
  2E ACCCGATCTACGGCGCCCCTTTGT (?)   TRSTAPLC  
  50S ACAGGGGGGTAC TTGGGT (D1/D2)   TLG  
  47S ACAGTGGG CGGT   TVGG  
  21S ACTACAGTGGGT   TTVG  
  27S ACAGACAGTGGG   TDSG