Skip to main content

Table 1 Primer sequences used for Cyproquant assays Table shows position of amplification product within cDNA sequence (upper line) and within genomic sequence (lower line). GenBank accession numbers are indicated.

From: CyProQuant-PCR: a real time RT-PCR technique for profiling human cytokines, based on external RNA standards, readily automatable for clinical use

Gene name 5'-3' primer sequence Position cDNA-gene Accesion Number
IL-1β FW CCTGTCCTGCGTGTTGAAAGA 639–788 NM_000576
  RW GGGAACTGGGCAGACTCAAA Int. Span. M15840
IL-4 FW AACAGCCTCACAGAGCAGAAGAC 177–278 BC070123
  RW GCCCTGCAGAAGGTTTCCTT Int. Span. AF395008
IL-10 FW GCTGGAGGACTTTAAGGGTTACCT 210–318 AY029171
  RW CTTGATGTCTGGGTCTTGGTTCT Int. Span. AF418271
IL-12p40 FW CATGGTGGATGCCGTTCA 636–767 AF180563
  RW ACCTCCACCTGCCGAGAAT Int. Span. AY008847
IL-13 FW ACAGCCCTCAGGGAGCTCAT 135–231 NM_002188
  RW TCAGGTTGATGCTCCATACCAT Int. Span. AF377331
IL-15 FW CCATCCAGTGCTACTTGTGTTTACTT 351–466 U14407
  RW CCAGTTGGCTTCTGTTTTAGGAA Int. Span. X91233
IL-18 FW GACGCATGCCCTCAATCC 966–1071 NM_001562
  RW CTAGAGCGCAATGGTGCAATC Exon E17138
IFN-γ FW GTTTTGGGTTCTCTTGGCTGTTA 151–263 NM_000619
  RW AAAAGAGTTCCATTATCCGCTACATC Int. Span. AF375790
MIF FW GCCCGGACAGGGTCTACA 322–399 M25639
  RW CTTAGGCGAAGGTGGAGTTGTT Int. Span. L19686
TGF-β1 FW CAAGGGCTACCATGCCAACT 1786–1869 NM_000660
  RW AGGGCCAGGACCTTGCTG Int. Span. X05839
TNF-α FW CCCCAGGGACCTCTCTCTAATC 358–455 NM_000594
  RW GGTTTGCTACAACATGGGCTACA Int. Span. AB088112
β2-MG FW AATTGAAAAAGTGGAGCATTCAGA 255–389 NM_004048
  RW GGCTGTGACAAAGTCACATGGTT Exon M17987
UBC FW ATTTGGGTCGCGGTTCTTG 20–152 BC039193
  RW TGCCTTGACATTCTCGATGGT Int. Span. D63791
YWHAZ FW ACTTTTGGTACATTGTGGCTTCAA 1090–1183 NM_003406
  RW CCGCCAGGACAAACCAGTAT Exon NC_000008
  1. Note: FW = Forward primer; RW = Reverse primer; Int. Span. = Intron spanning, i.e. Primers derived from different exons; Exon = both primers derived from the same exon. β2-MG = β2-microglobulin. UBC = Ubiquitin C. YWHAZ = tyrosine 3-monooxygenase tryptophan 5-monooxygenase activation protein, zeta polypeptide.