Skip to main content

Table 1 Primers for qPCR analysis

From: Human NK cells adapt their immune response towards increasing multiplicities of infection of Aspergillus fumigatus

Gene Forward Reverse Product size (bp)
ALAS1a GGCAGCACAGATGAATCAGA CCTCCATCGGTTTTCACACT 150
CCL3 (MIP-1α) TGCAACCAGTTCTCTGCATC TTTCTGGACCCACTCCTCAC 198
CCL4 (MIP-1β) GCTTCCTCGCAACTTTGTGG TCACTGGGATCAGCACAGAC 111
CCL5 (RANTES) TCATTGCTACTGCCCTCTGC TACTCCTTGATGTGGGCACG 115
CXCL8 (IL-8) GGTGCAGTTTTGCCAAGGAG TTCCTTGGGGTCCAGACAGA 183
XCL1 (lymphotactin)b CTCCTTGGCATCTGCTCTCT CCTTCCGTGATGGTGTAGGTC 137
IFNG (IFN-γ)c GCATCCAAAAGAGTGTGGAG GCAGGCAGGACAACCATTAC 255
TNF (TNF-α) TGCTTGTTCCTCAGCCTCTT TGGGCTACAGGCTTGTCACT 185
CSF2 (GM-CSF) GCCCTGGGAGCATGTGAATG CTTGTAGTGGCTGGCCATCAT 223
IL1A (IL-1α) TGATCAGTACCTCACGGCTG TGGTCTTCATCTTGGGCAGT 156
IL16 (IL-16) CGAAGACTCAGCTGCAAATGG GCAGGGAGATAACGGACTGAC 167
GZMB (granzyme B) TGCGAATCTGACTTACGCCA GCATGCCATTGTTTCGTCCA 160
  1. aALAS1 is well established as a housekeeping gene for the normalization of gene expression by cells confronted with different stimuli [63,64,65,66,67]. In general, primers were designed to include as much transcript variants of the mentioned gene as possible. Within this context, bprimers for XCL1/lymphotactin qualify also for the amplification of XCL2, which differs just slightly with regard to the amino acids, but show the same functionality in vitro [68]. cPrimers for IFNG were already published by Bouzani et al. [27]